FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623599_at:

>probe:Drosophila_2:1623599_at:421:681; Interrogation_Position=184; Antisense; TATACGCGACTACAGCGAGGCGGAC
>probe:Drosophila_2:1623599_at:502:555; Interrogation_Position=205; Antisense; GGACCTCGAGCGTCTGCTAGATCAA
>probe:Drosophila_2:1623599_at:133:211; Interrogation_Position=243; Antisense; AAGAGCCCCTCGAGGATGATGAGCT
>probe:Drosophila_2:1623599_at:358:207; Interrogation_Position=293; Antisense; AAGCTGGACCTGAGCAATCTGGACA
>probe:Drosophila_2:1623599_at:627:237; Interrogation_Position=308; Antisense; AATCTGGACAGCAAGAGCCCCGAGG
>probe:Drosophila_2:1623599_at:338:135; Interrogation_Position=362; Antisense; ACGCTGATGACCTTCGTTTCGGTGA
>probe:Drosophila_2:1623599_at:195:549; Interrogation_Position=403; Antisense; GGAGGAGAGCGACACCATCACCAAG
>probe:Drosophila_2:1623599_at:548:117; Interrogation_Position=426; Antisense; AGCTCTGGCAGACAAGCCTCTGGAA
>probe:Drosophila_2:1623599_at:98:331; Interrogation_Position=464; Antisense; GCGGAGCGCTACATGGTTGACGATA
>probe:Drosophila_2:1623599_at:132:721; Interrogation_Position=500; Antisense; TTCCTCTTCAAGGACGGCACACAAG
>probe:Drosophila_2:1623599_at:209:75; Interrogation_Position=537; Antisense; AGGACTTCCTCATCGAGCAGGAACG
>probe:Drosophila_2:1623599_at:297:427; Interrogation_Position=590; Antisense; GAGTACCCAGGTGTCAATGCGAAAA
>probe:Drosophila_2:1623599_at:256:553; Interrogation_Position=616; Antisense; GGACGAACTGTAGGCCGGTTCCACG
>probe:Drosophila_2:1623599_at:325:309; Interrogation_Position=646; Antisense; CCAGCACATCAAAACATTCTCACTA

Paste this into a BLAST search page for me
TATACGCGACTACAGCGAGGCGGACGGACCTCGAGCGTCTGCTAGATCAAAAGAGCCCCTCGAGGATGATGAGCTAAGCTGGACCTGAGCAATCTGGACAAATCTGGACAGCAAGAGCCCCGAGGACGCTGATGACCTTCGTTTCGGTGAGGAGGAGAGCGACACCATCACCAAGAGCTCTGGCAGACAAGCCTCTGGAAGCGGAGCGCTACATGGTTGACGATATTCCTCTTCAAGGACGGCACACAAGAGGACTTCCTCATCGAGCAGGAACGGAGTACCCAGGTGTCAATGCGAAAAGGACGAACTGTAGGCCGGTTCCACGCCAGCACATCAAAACATTCTCACTA

Full Affymetrix probeset data:

Annotations for 1623599_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720