Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623601_at:

>probe:Drosophila_2:1623601_at:65:45; Interrogation_Position=1021; Antisense; ATCCCTACGGCATCAGTCGGGTGAT
>probe:Drosophila_2:1623601_at:264:607; Interrogation_Position=1042; Antisense; TGATGAGCTCATTCGCCTTCGATGA
>probe:Drosophila_2:1623601_at:330:243; Interrogation_Position=1106; Antisense; AATTTCACCCGAGTTCGATGCGGAT
>probe:Drosophila_2:1623601_at:589:325; Interrogation_Position=1156; Antisense; GCGAGCATCGTTGGCGTCAGATCTA
>probe:Drosophila_2:1623601_at:228:63; Interrogation_Position=1185; Antisense; ATGGTGGGCTTCAAGAACGCCGTTC
>probe:Drosophila_2:1623601_at:328:713; Interrogation_Position=1260; Antisense; TTCTGTCGCGGCAACAAGGGCTTCC
>probe:Drosophila_2:1623601_at:535:81; Interrogation_Position=1276; Antisense; AGGGCTTCCTGGCTATCAACAACAA
>probe:Drosophila_2:1623601_at:249:285; Interrogation_Position=1302; Antisense; CTGTACGATTTGTCGCAGGATCTGA
>probe:Drosophila_2:1623601_at:9:79; Interrogation_Position=1318; Antisense; AGGATCTGAATACCTGTCTGCCTGC
>probe:Drosophila_2:1623601_at:494:625; Interrogation_Position=1340; Antisense; TGCCGGAACCTACTGCGATGTGATT
>probe:Drosophila_2:1623601_at:264:327; Interrogation_Position=1354; Antisense; GCGATGTGATTTCCGGCAGCCTGAT
>probe:Drosophila_2:1623601_at:680:53; Interrogation_Position=1450; Antisense; ATGACTTCGACGGTGTACTGGCCCT
>probe:Drosophila_2:1623601_at:372:41; Interrogation_Position=1514; Antisense; ATCTGGGCTTTATTTTTGTCTCAAA
>probe:Drosophila_2:1623601_at:420:491; Interrogation_Position=989; Antisense; GTACAAAATGGCAACCGCCTTCCAT

Paste this into a BLAST search page for me
ATCCCTACGGCATCAGTCGGGTGATTGATGAGCTCATTCGCCTTCGATGAAATTTCACCCGAGTTCGATGCGGATGCGAGCATCGTTGGCGTCAGATCTAATGGTGGGCTTCAAGAACGCCGTTCTTCTGTCGCGGCAACAAGGGCTTCCAGGGCTTCCTGGCTATCAACAACAACTGTACGATTTGTCGCAGGATCTGAAGGATCTGAATACCTGTCTGCCTGCTGCCGGAACCTACTGCGATGTGATTGCGATGTGATTTCCGGCAGCCTGATATGACTTCGACGGTGTACTGGCCCTATCTGGGCTTTATTTTTGTCTCAAAGTACAAAATGGCAACCGCCTTCCAT

Full Affymetrix probeset data:

Annotations for 1623601_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime