FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623603_at:

>probe:Drosophila_2:1623603_at:188:1; Interrogation_Position=1095; Antisense; CCGAACGAAGGCACCATTATTAGCT
>probe:Drosophila_2:1623603_at:1:133; Interrogation_Position=1099; Antisense; ACGAAGGCACCATTATTAGCTGATA
>probe:Drosophila_2:1623603_at:364:371; Interrogation_Position=1101; Antisense; GAAGGCACCATTATTAGCTGATATC
>probe:Drosophila_2:1623603_at:99:73; Interrogation_Position=1103; Antisense; AGGCACCATTATTAGCTGATATCGA
>probe:Drosophila_2:1623603_at:229:355; Interrogation_Position=1105; Antisense; GCACCATTATTAGCTGATATCGAGT
>probe:Drosophila_2:1623603_at:575:687; Interrogation_Position=1112; Antisense; TATTAGCTGATATCGAGTTAGGCCA
>probe:Drosophila_2:1623603_at:243:705; Interrogation_Position=1114; Antisense; TTAGCTGATATCGAGTTAGGCCATC
>probe:Drosophila_2:1623603_at:336:457; Interrogation_Position=1120; Antisense; GATATCGAGTTAGGCCATCAGCAGC
>probe:Drosophila_2:1623603_at:570:39; Interrogation_Position=1123; Antisense; ATCGAGTTAGGCCATCAGCAGCTGG
>probe:Drosophila_2:1623603_at:66:295; Interrogation_Position=1125; Antisense; CGAGTTAGGCCATCAGCAGCTGGAC
>probe:Drosophila_2:1623603_at:395:353; Interrogation_Position=1140; Antisense; GCAGCTGGACACACTATCATCCTAT
>probe:Drosophila_2:1623603_at:360:333; Interrogation_Position=1143; Antisense; GCTGGACACACTATCATCCTATTGA
>probe:Drosophila_2:1623603_at:425:383; Interrogation_Position=943; Antisense; GAACTGTTGGGAATCAAACTCAAAA
>probe:Drosophila_2:1623603_at:296:467; Interrogation_Position=948; Antisense; GTTGGGAATCAAACTCAAAATGAAG

Paste this into a BLAST search page for me
CCGAACGAAGGCACCATTATTAGCTACGAAGGCACCATTATTAGCTGATAGAAGGCACCATTATTAGCTGATATCAGGCACCATTATTAGCTGATATCGAGCACCATTATTAGCTGATATCGAGTTATTAGCTGATATCGAGTTAGGCCATTAGCTGATATCGAGTTAGGCCATCGATATCGAGTTAGGCCATCAGCAGCATCGAGTTAGGCCATCAGCAGCTGGCGAGTTAGGCCATCAGCAGCTGGACGCAGCTGGACACACTATCATCCTATGCTGGACACACTATCATCCTATTGAGAACTGTTGGGAATCAAACTCAAAAGTTGGGAATCAAACTCAAAATGAAG

Full Affymetrix probeset data:

Annotations for 1623603_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720