FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623604_at:

>probe:Drosophila_2:1623604_at:85:691; Interrogation_Position=1185; Antisense; TTTGTTATCTGTATGACTCGCCGGT
>probe:Drosophila_2:1623604_at:363:89; Interrogation_Position=1211; Antisense; AGTCTATACTATACATTCCGGGCCT
>probe:Drosophila_2:1623604_at:215:223; Interrogation_Position=1284; Antisense; AAGGGATTGTCAGTCTGTGCCTGCT
>probe:Drosophila_2:1623604_at:18:673; Interrogation_Position=1331; Antisense; TACGAACCGCAGTTATGGTCCCATT
>probe:Drosophila_2:1623604_at:616:503; Interrogation_Position=1348; Antisense; GTCCCATTTCCGAGAGCTTCAGATA
>probe:Drosophila_2:1623604_at:90:283; Interrogation_Position=1379; Antisense; CTGCGGGTGGTCTTCAAATGGCTTA
>probe:Drosophila_2:1623604_at:362:51; Interrogation_Position=1403; Antisense; ATGCGAGCGTTTTCCGGACATTTGC
>probe:Drosophila_2:1623604_at:464:291; Interrogation_Position=1432; Antisense; CGATCAATTGCTGGTCCTCTGGGAT
>probe:Drosophila_2:1623604_at:231:545; Interrogation_Position=1453; Antisense; GGATCTGATCCTTGGCTTTGATAGC
>probe:Drosophila_2:1623604_at:728:455; Interrogation_Position=1472; Antisense; GATAGCTTGGAGATCCTTCCTCTAT
>probe:Drosophila_2:1623604_at:555:81; Interrogation_Position=1539; Antisense; AGGTGGCCTCGTTGGATAGCATCGA
>probe:Drosophila_2:1623604_at:363:347; Interrogation_Position=1557; Antisense; GCATCGAAGCGATTCTGGCAGACTT
>probe:Drosophila_2:1623604_at:83:569; Interrogation_Position=1573; Antisense; GGCAGACTTGTCCTCTATCAAGGTG
>probe:Drosophila_2:1623604_at:319:509; Interrogation_Position=1607; Antisense; GTGCAACTAGCCCTAAGTCGAGACT

Paste this into a BLAST search page for me
TTTGTTATCTGTATGACTCGCCGGTAGTCTATACTATACATTCCGGGCCTAAGGGATTGTCAGTCTGTGCCTGCTTACGAACCGCAGTTATGGTCCCATTGTCCCATTTCCGAGAGCTTCAGATACTGCGGGTGGTCTTCAAATGGCTTAATGCGAGCGTTTTCCGGACATTTGCCGATCAATTGCTGGTCCTCTGGGATGGATCTGATCCTTGGCTTTGATAGCGATAGCTTGGAGATCCTTCCTCTATAGGTGGCCTCGTTGGATAGCATCGAGCATCGAAGCGATTCTGGCAGACTTGGCAGACTTGTCCTCTATCAAGGTGGTGCAACTAGCCCTAAGTCGAGACT

Full Affymetrix probeset data:

Annotations for 1623604_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720