FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623606_at:

>probe:Drosophila_2:1623606_at:587:603; Interrogation_Position=135; Antisense; TGATTAGCCACAGCACTTCGACATG
>probe:Drosophila_2:1623606_at:720:137; Interrogation_Position=212; Antisense; ACGATGTCGCCGTCACCGGTGAGAA
>probe:Drosophila_2:1623606_at:537:215; Interrogation_Position=235; Antisense; AAGATCAACACCATCCTGAAGGCCG
>probe:Drosophila_2:1623606_at:204:425; Interrogation_Position=310; Antisense; GAGGGCATCAACGTCAAGGACCTGA
>probe:Drosophila_2:1623606_at:508:225; Interrogation_Position=325; Antisense; AAGGACCTGATCACCAACATCGGAT
>probe:Drosophila_2:1623606_at:161:77; Interrogation_Position=446; Antisense; AGGAGTCCGACCAGTCTGACGACGA
>probe:Drosophila_2:1623606_at:324:537; Interrogation_Position=481; Antisense; GGTCTGTTCGACTAAATCCTCTAGA
>probe:Drosophila_2:1623606_at:670:679; Interrogation_Position=49; Antisense; TAGGATTTTGACCAGCGTGCTTGTT
>probe:Drosophila_2:1623606_at:330:99; Interrogation_Position=503; Antisense; AGAGAACTTCTCGACAACCGGACAT
>probe:Drosophila_2:1623606_at:683:201; Interrogation_Position=518; Antisense; AACCGGACATCCGTTGTGTTTGTGC
>probe:Drosophila_2:1623606_at:243:515; Interrogation_Position=533; Antisense; GTGTTTGTGCTGTAATCCTCGAGAG
>probe:Drosophila_2:1623606_at:526:271; Interrogation_Position=550; Antisense; CTCGAGAGGTGGACGTGTACCCGTT
>probe:Drosophila_2:1623606_at:155:297; Interrogation_Position=577; Antisense; CCGACCTGCGTACACGTTTTTAATG
>probe:Drosophila_2:1623606_at:532:501; Interrogation_Position=77; Antisense; GTCCCGAGCTAAGGCCATTTGTTAT

Paste this into a BLAST search page for me
TGATTAGCCACAGCACTTCGACATGACGATGTCGCCGTCACCGGTGAGAAAAGATCAACACCATCCTGAAGGCCGGAGGGCATCAACGTCAAGGACCTGAAAGGACCTGATCACCAACATCGGATAGGAGTCCGACCAGTCTGACGACGAGGTCTGTTCGACTAAATCCTCTAGATAGGATTTTGACCAGCGTGCTTGTTAGAGAACTTCTCGACAACCGGACATAACCGGACATCCGTTGTGTTTGTGCGTGTTTGTGCTGTAATCCTCGAGAGCTCGAGAGGTGGACGTGTACCCGTTCCGACCTGCGTACACGTTTTTAATGGTCCCGAGCTAAGGCCATTTGTTAT

Full Affymetrix probeset data:

Annotations for 1623606_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720