FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623609_at:

>probe:Drosophila_2:1623609_at:533:529; Interrogation_Position=161; Antisense; GGGATCGCTACAACGTATTTCGCCA
>probe:Drosophila_2:1623609_at:607:687; Interrogation_Position=176; Antisense; TATTTCGCCAGGTTTTGCCCAACTA
>probe:Drosophila_2:1623609_at:232:313; Interrogation_Position=216; Antisense; GCCAGACGACGATATGCTAGCAAAC
>probe:Drosophila_2:1623609_at:437:429; Interrogation_Position=247; Antisense; GAGTTATTCCAGGAGCAGCTTTCAA
>probe:Drosophila_2:1623609_at:369:351; Interrogation_Position=261; Antisense; GCAGCTTTCAATATCGATCTTCACA
>probe:Drosophila_2:1623609_at:538:105; Interrogation_Position=285; Antisense; AGACACTGAATCATCCGGCGAGGAG
>probe:Drosophila_2:1623609_at:405:551; Interrogation_Position=306; Antisense; GGAGACCTGCGAATCCAGTCTGGAT
>probe:Drosophila_2:1623609_at:502:679; Interrogation_Position=330; Antisense; TAGTGACTCCGAGCAGATCAGCATC
>probe:Drosophila_2:1623609_at:645:545; Interrogation_Position=360; Antisense; GGATCGTCATCATTAGACCACATTC
>probe:Drosophila_2:1623609_at:11:61; Interrogation_Position=402; Antisense; ATGTCTTTCGTCTAATGTCTGCCAA
>probe:Drosophila_2:1623609_at:437:139; Interrogation_Position=450; Antisense; ACGTAGCCACTAATTGTTCGACAAT
>probe:Drosophila_2:1623609_at:673:549; Interrogation_Position=46; Antisense; GGAGTGAGCAATCTGCTACCCGATT
>probe:Drosophila_2:1623609_at:551:617; Interrogation_Position=70; Antisense; TGCAGCATTGCAAACCGGGTCCATC
>probe:Drosophila_2:1623609_at:39:535; Interrogation_Position=87; Antisense; GGTCCATCTGTTCTCTTTGCTGCAG

Paste this into a BLAST search page for me
GGGATCGCTACAACGTATTTCGCCATATTTCGCCAGGTTTTGCCCAACTAGCCAGACGACGATATGCTAGCAAACGAGTTATTCCAGGAGCAGCTTTCAAGCAGCTTTCAATATCGATCTTCACAAGACACTGAATCATCCGGCGAGGAGGGAGACCTGCGAATCCAGTCTGGATTAGTGACTCCGAGCAGATCAGCATCGGATCGTCATCATTAGACCACATTCATGTCTTTCGTCTAATGTCTGCCAAACGTAGCCACTAATTGTTCGACAATGGAGTGAGCAATCTGCTACCCGATTTGCAGCATTGCAAACCGGGTCCATCGGTCCATCTGTTCTCTTTGCTGCAG

Full Affymetrix probeset data:

Annotations for 1623609_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720