FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623610_at:

>probe:Drosophila_2:1623610_at:353:61; Interrogation_Position=206; Antisense; ATGTACTCGTCCTGCGAGCGGCCAA
>probe:Drosophila_2:1623610_at:166:49; Interrogation_Position=234; Antisense; ATCCAGGGCCATTGCAACAAGCGCA
>probe:Drosophila_2:1623610_at:463:159; Interrogation_Position=250; Antisense; ACAAGCGCAGATGCGGCTACGCGGT
>probe:Drosophila_2:1623610_at:305:329; Interrogation_Position=283; Antisense; GCGTCAGCGGCAGAAACAACACTTG
>probe:Drosophila_2:1623610_at:726:493; Interrogation_Position=315; Antisense; GTCAATTTGGCCGACAGCTATACAA
>probe:Drosophila_2:1623610_at:30:221; Interrogation_Position=488; Antisense; AAGTGCAACATCAGGCTCAACGAGT
>probe:Drosophila_2:1623610_at:506:367; Interrogation_Position=513; Antisense; GGGCGTTTTAATACCTCCTTCGCTG
>probe:Drosophila_2:1623610_at:34:717; Interrogation_Position=531; Antisense; TTCGCTGCACGTTGATTTGACGCAT
>probe:Drosophila_2:1623610_at:79:409; Interrogation_Position=549; Antisense; GACGCATGTGCAACAGGGCTTTCAG
>probe:Drosophila_2:1623610_at:173:525; Interrogation_Position=564; Antisense; GGGCTTTCAGAATTTCCTCGACTTT
>probe:Drosophila_2:1623610_at:314:281; Interrogation_Position=580; Antisense; CTCGACTTTTTCCAACTGCATTTAT
>probe:Drosophila_2:1623610_at:562:229; Interrogation_Position=607; Antisense; AATGTCACCGTCGATTTTCTACGTG
>probe:Drosophila_2:1623610_at:611:517; Interrogation_Position=634; Antisense; GTGGGTGAGTACACACAAGCCGAAA
>probe:Drosophila_2:1623610_at:668:73; Interrogation_Position=671; Antisense; AGGAACAGGCCAAGCATCCTCGTTC

Paste this into a BLAST search page for me
ATGTACTCGTCCTGCGAGCGGCCAAATCCAGGGCCATTGCAACAAGCGCAACAAGCGCAGATGCGGCTACGCGGTGCGTCAGCGGCAGAAACAACACTTGGTCAATTTGGCCGACAGCTATACAAAAGTGCAACATCAGGCTCAACGAGTGGGCGTTTTAATACCTCCTTCGCTGTTCGCTGCACGTTGATTTGACGCATGACGCATGTGCAACAGGGCTTTCAGGGGCTTTCAGAATTTCCTCGACTTTCTCGACTTTTTCCAACTGCATTTATAATGTCACCGTCGATTTTCTACGTGGTGGGTGAGTACACACAAGCCGAAAAGGAACAGGCCAAGCATCCTCGTTC

Full Affymetrix probeset data:

Annotations for 1623610_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720