Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623611_at:

>probe:Drosophila_2:1623611_at:65:597; Interrogation_Position=102; Antisense; TGTGCCACCTTTAAGTATTCAGCCC
>probe:Drosophila_2:1623611_at:198:129; Interrogation_Position=108; Antisense; ACCTTTAAGTATTCAGCCCTGCTCA
>probe:Drosophila_2:1623611_at:574:217; Interrogation_Position=114; Antisense; AAGTATTCAGCCCTGCTCATCCAAC
>probe:Drosophila_2:1623611_at:673:117; Interrogation_Position=205; Antisense; AGCTCCATCATATGGGTCCCCAGCA
>probe:Drosophila_2:1623611_at:245:23; Interrogation_Position=214; Antisense; ATATGGGTCCCCAGCATTTACATCT
>probe:Drosophila_2:1623611_at:39:281; Interrogation_Position=22; Antisense; CTCAGCGATTTGCAGGTGATCCAGG
>probe:Drosophila_2:1623611_at:348:303; Interrogation_Position=222; Antisense; CCCCAGCATTTACATCTTCATCTGA
>probe:Drosophila_2:1623611_at:660:459; Interrogation_Position=28; Antisense; GATTTGCAGGTGATCCAGGTGTATA
>probe:Drosophila_2:1623611_at:524:531; Interrogation_Position=36; Antisense; GGTGATCCAGGTGTATATAGTATTA
>probe:Drosophila_2:1623611_at:492:685; Interrogation_Position=56; Antisense; TATTAAATGCCAGGAATCGGACCGC
>probe:Drosophila_2:1623611_at:117:315; Interrogation_Position=64; Antisense; GCCAGGAATCGGACCGCATCCGAAT
>probe:Drosophila_2:1623611_at:709:269; Interrogation_Position=80; Antisense; CATCCGAATCGAACGATGCGTATGT
>probe:Drosophila_2:1623611_at:666:381; Interrogation_Position=90; Antisense; GAACGATGCGTATGTGCCACCTTTA
>probe:Drosophila_2:1623611_at:620:293; Interrogation_Position=93; Antisense; CGATGCGTATGTGCCACCTTTAAGT

Paste this into a BLAST search page for me
TGTGCCACCTTTAAGTATTCAGCCCACCTTTAAGTATTCAGCCCTGCTCAAAGTATTCAGCCCTGCTCATCCAACAGCTCCATCATATGGGTCCCCAGCAATATGGGTCCCCAGCATTTACATCTCTCAGCGATTTGCAGGTGATCCAGGCCCCAGCATTTACATCTTCATCTGAGATTTGCAGGTGATCCAGGTGTATAGGTGATCCAGGTGTATATAGTATTATATTAAATGCCAGGAATCGGACCGCGCCAGGAATCGGACCGCATCCGAATCATCCGAATCGAACGATGCGTATGTGAACGATGCGTATGTGCCACCTTTACGATGCGTATGTGCCACCTTTAAGT

Full Affymetrix probeset data:

Annotations for 1623611_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime