FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623612_at:

>probe:Drosophila_2:1623612_at:378:203; Interrogation_Position=1001; Antisense; AAGCGGATTTGAGCGATCTTTTCGA
>probe:Drosophila_2:1623612_at:350:171; Interrogation_Position=1041; Antisense; AAAGATTTCGGAGGCTAGACACAAA
>probe:Drosophila_2:1623612_at:21:377; Interrogation_Position=1108; Antisense; GAAGCAGAGGTCCAACCCGAAGTCC
>probe:Drosophila_2:1623612_at:243:505; Interrogation_Position=1129; Antisense; GTCCTTAAGAAGAATCCCGATCGCA
>probe:Drosophila_2:1623612_at:190:449; Interrogation_Position=1147; Antisense; GATCGCAAGTTCTTCAAGGCCGACC
>probe:Drosophila_2:1623612_at:56:603; Interrogation_Position=1179; Antisense; TGTTTTTGCCATACGCGACAGGAAA
>probe:Drosophila_2:1623612_at:332:665; Interrogation_Position=1210; Antisense; TACTTCGTTGGCCATTTCGTTAAGC
>probe:Drosophila_2:1623612_at:362:715; Interrogation_Position=1225; Antisense; TTCGTTAAGCCCTAATTGCATGTAT
>probe:Drosophila_2:1623612_at:436:607; Interrogation_Position=1255; Antisense; TGATGATGGCCCACAGGCAATCACG
>probe:Drosophila_2:1623612_at:587:443; Interrogation_Position=801; Antisense; GATGATTATCTTACCAACTGCTATT
>probe:Drosophila_2:1623612_at:317:195; Interrogation_Position=816; Antisense; AACTGCTATTGATGGCTTGCCCGAA
>probe:Drosophila_2:1623612_at:330:401; Interrogation_Position=865; Antisense; GACATGAACGAGGTAGCCGCCAAAA
>probe:Drosophila_2:1623612_at:214:245; Interrogation_Position=923; Antisense; AATTCAGGATCGAGTGCACTGTTGA
>probe:Drosophila_2:1623612_at:498:355; Interrogation_Position=938; Antisense; GCACTGTTGATCTTAAGGTTCCACT

Paste this into a BLAST search page for me
AAGCGGATTTGAGCGATCTTTTCGAAAAGATTTCGGAGGCTAGACACAAAGAAGCAGAGGTCCAACCCGAAGTCCGTCCTTAAGAAGAATCCCGATCGCAGATCGCAAGTTCTTCAAGGCCGACCTGTTTTTGCCATACGCGACAGGAAATACTTCGTTGGCCATTTCGTTAAGCTTCGTTAAGCCCTAATTGCATGTATTGATGATGGCCCACAGGCAATCACGGATGATTATCTTACCAACTGCTATTAACTGCTATTGATGGCTTGCCCGAAGACATGAACGAGGTAGCCGCCAAAAAATTCAGGATCGAGTGCACTGTTGAGCACTGTTGATCTTAAGGTTCCACT

Full Affymetrix probeset data:

Annotations for 1623612_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720