Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623613_at:

>probe:Drosophila_2:1623613_at:726:39; Interrogation_Position=1731; Antisense; ATCGGAGCTCTTTCACGGCGGCAAG
>probe:Drosophila_2:1623613_at:660:221; Interrogation_Position=1753; Antisense; AAGTGGCTGGGCATTCTCTGCTACG
>probe:Drosophila_2:1623613_at:659:715; Interrogation_Position=1789; Antisense; TTCGTCATCATTGTGCTGCTGATCA
>probe:Drosophila_2:1623613_at:33:655; Interrogation_Position=1811; Antisense; TCAATGTCTTTGTGTCCCTGATCAA
>probe:Drosophila_2:1623613_at:673:651; Interrogation_Position=1832; Antisense; TCAACGACTACTTTACCGTGGCGAA
>probe:Drosophila_2:1623613_at:368:545; Interrogation_Position=1886; Antisense; GGATCACTTTCTTCGAATTTCTGGT
>probe:Drosophila_2:1623613_at:642:243; Interrogation_Position=1901; Antisense; AATTTCTGGTCGTCGAGTTCTCGGG
>probe:Drosophila_2:1623613_at:46:139; Interrogation_Position=2000; Antisense; ACGTGAGCCGGAAACTGGACTCCAT
>probe:Drosophila_2:1623613_at:396:349; Interrogation_Position=2058; Antisense; GCAGGGCCGCCATCACGTGAGTAGA
>probe:Drosophila_2:1623613_at:609:425; Interrogation_Position=2076; Antisense; GAGTAGACCAGTATCGGCCGAGGAT
>probe:Drosophila_2:1623613_at:461:585; Interrogation_Position=2108; Antisense; TGGAGTACAAGGATCGCGGCGACAA
>probe:Drosophila_2:1623613_at:232:397; Interrogation_Position=2128; Antisense; GACAAGATGGTCAACGTGCACTATA
>probe:Drosophila_2:1623613_at:583:509; Interrogation_Position=2143; Antisense; GTGCACTATATTCTCAACATCCAGC
>probe:Drosophila_2:1623613_at:722:117; Interrogation_Position=2165; Antisense; AGCTCACCTTGATCCGAATGTTTCT

Paste this into a BLAST search page for me
ATCGGAGCTCTTTCACGGCGGCAAGAAGTGGCTGGGCATTCTCTGCTACGTTCGTCATCATTGTGCTGCTGATCATCAATGTCTTTGTGTCCCTGATCAATCAACGACTACTTTACCGTGGCGAAGGATCACTTTCTTCGAATTTCTGGTAATTTCTGGTCGTCGAGTTCTCGGGACGTGAGCCGGAAACTGGACTCCATGCAGGGCCGCCATCACGTGAGTAGAGAGTAGACCAGTATCGGCCGAGGATTGGAGTACAAGGATCGCGGCGACAAGACAAGATGGTCAACGTGCACTATAGTGCACTATATTCTCAACATCCAGCAGCTCACCTTGATCCGAATGTTTCT

Full Affymetrix probeset data:

Annotations for 1623613_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime