FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623614_at:

>probe:Drosophila_2:1623614_at:17:197; Interrogation_Position=130; Antisense; AACGGAGGCCACTGCCTGGATGGTT
>probe:Drosophila_2:1623614_at:271:483; Interrogation_Position=147; Antisense; GGATGGTTACCCAGTGCGGAAACGA
>probe:Drosophila_2:1623614_at:451:205; Interrogation_Position=16; Antisense; AAGCCGTCGGATTTGTTGCTGGTGC
>probe:Drosophila_2:1623614_at:141:501; Interrogation_Position=160; Antisense; GTGCGGAAACGAGCCAAGGCGCCCA
>probe:Drosophila_2:1623614_at:374:135; Interrogation_Position=184; Antisense; ACGCATCCACTTTGAATGCCACTGG
>probe:Drosophila_2:1623614_at:252:369; Interrogation_Position=197; Antisense; GAATGCCACTGGAAATGGTCATGGA
>probe:Drosophila_2:1623614_at:138:439; Interrogation_Position=232; Antisense; GAGGCACTCGTGGTGGAGACACATC
>probe:Drosophila_2:1623614_at:71:587; Interrogation_Position=245; Antisense; TGGAGACACATCTGCGGTCGACCGC
>probe:Drosophila_2:1623614_at:140:317; Interrogation_Position=268; Antisense; GCCTGCCCGCTGAAATGCCATTTAG
>probe:Drosophila_2:1623614_at:319:395; Interrogation_Position=279; Antisense; GAAATGCCATTTAGCTGGGAAACTG
>probe:Drosophila_2:1623614_at:488:421; Interrogation_Position=306; Antisense; GAGCAAATAATGTCGGCCACTGCAG
>probe:Drosophila_2:1623614_at:208:639; Interrogation_Position=318; Antisense; TCGGCCACTGCAGCTGACATCAAAG
>probe:Drosophila_2:1623614_at:559:333; Interrogation_Position=330; Antisense; GCTGACATCAAAGGCTCTTCCTGAA
>probe:Drosophila_2:1623614_at:342:551; Interrogation_Position=42; Antisense; GGAGAAGGGTCCTTCGACCACACCA

Paste this into a BLAST search page for me
AACGGAGGCCACTGCCTGGATGGTTGGATGGTTACCCAGTGCGGAAACGAAAGCCGTCGGATTTGTTGCTGGTGCGTGCGGAAACGAGCCAAGGCGCCCAACGCATCCACTTTGAATGCCACTGGGAATGCCACTGGAAATGGTCATGGAGAGGCACTCGTGGTGGAGACACATCTGGAGACACATCTGCGGTCGACCGCGCCTGCCCGCTGAAATGCCATTTAGGAAATGCCATTTAGCTGGGAAACTGGAGCAAATAATGTCGGCCACTGCAGTCGGCCACTGCAGCTGACATCAAAGGCTGACATCAAAGGCTCTTCCTGAAGGAGAAGGGTCCTTCGACCACACCA

Full Affymetrix probeset data:

Annotations for 1623614_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720