Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623615_at:

>probe:Drosophila_2:1623615_at:590:707; Interrogation_Position=1006; Antisense; TTAACTTTCCGAGAGTCAGCGCAAA
>probe:Drosophila_2:1623615_at:338:165; Interrogation_Position=1028; Antisense; AAATCTGTTGAAGAGCAGCCCCACC
>probe:Drosophila_2:1623615_at:433:265; Interrogation_Position=514; Antisense; CAGTCAGAGATGGACCGGCTGGTCA
>probe:Drosophila_2:1623615_at:398:589; Interrogation_Position=533; Antisense; TGGTCAAGTCGTTCTCGGAGCGCAA
>probe:Drosophila_2:1623615_at:581:275; Interrogation_Position=567; Antisense; CTTCTTGCGCTACATGCGGAAGGGT
>probe:Drosophila_2:1623615_at:342:653; Interrogation_Position=701; Antisense; TCAAGCAGTTGAATCTCGCCGGCGA
>probe:Drosophila_2:1623615_at:387:443; Interrogation_Position=742; Antisense; GATGATTCGGACTTCGATTCCGACG
>probe:Drosophila_2:1623615_at:613:375; Interrogation_Position=775; Antisense; GAAGACTCTGAGTTCGACTCCGAAG
>probe:Drosophila_2:1623615_at:1:555; Interrogation_Position=822; Antisense; GGAGCCACAGAAACCTGCTGCTAAG
>probe:Drosophila_2:1623615_at:364:695; Interrogation_Position=886; Antisense; TTTAGCAACTTGGTAGAGCACGATA
>probe:Drosophila_2:1623615_at:508:219; Interrogation_Position=911; Antisense; AAGTGGACCTGGAGAACCGATTCCA
>probe:Drosophila_2:1623615_at:90:305; Interrogation_Position=927; Antisense; CCGATTCCAGGCCAGAAGCTTGTTA
>probe:Drosophila_2:1623615_at:12:485; Interrogation_Position=974; Antisense; GTATCCTGCCCAAATAGCATTTTCG
>probe:Drosophila_2:1623615_at:646:115; Interrogation_Position=989; Antisense; AGCATTTTCGTGGAGTGTTAACTTT

Paste this into a BLAST search page for me
TTAACTTTCCGAGAGTCAGCGCAAAAAATCTGTTGAAGAGCAGCCCCACCCAGTCAGAGATGGACCGGCTGGTCATGGTCAAGTCGTTCTCGGAGCGCAACTTCTTGCGCTACATGCGGAAGGGTTCAAGCAGTTGAATCTCGCCGGCGAGATGATTCGGACTTCGATTCCGACGGAAGACTCTGAGTTCGACTCCGAAGGGAGCCACAGAAACCTGCTGCTAAGTTTAGCAACTTGGTAGAGCACGATAAAGTGGACCTGGAGAACCGATTCCACCGATTCCAGGCCAGAAGCTTGTTAGTATCCTGCCCAAATAGCATTTTCGAGCATTTTCGTGGAGTGTTAACTTT

Full Affymetrix probeset data:

Annotations for 1623615_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime