FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623618_at:

>probe:Drosophila_2:1623618_at:164:615; Interrogation_Position=1361; Antisense; TGAAGTACGGCTTTCTCCAGCTGAC
>probe:Drosophila_2:1623618_at:468:119; Interrogation_Position=1379; Antisense; AGCTGACCGAGGCACTGGCGTATCT
>probe:Drosophila_2:1623618_at:28:579; Interrogation_Position=1394; Antisense; TGGCGTATCTGCACTATTCCGGTCA
>probe:Drosophila_2:1623618_at:507:9; Interrogation_Position=1409; Antisense; ATTCCGGTCACGTAATTCATCGCAA
>probe:Drosophila_2:1623618_at:513:713; Interrogation_Position=1424; Antisense; TTCATCGCAATGTGTGTCCATCTTC
>probe:Drosophila_2:1623618_at:576:483; Interrogation_Position=1469; Antisense; GTATCTGGAAACTGGCCGGCATGGA
>probe:Drosophila_2:1623618_at:685:457; Interrogation_Position=1519; Antisense; GATTTGAACAGCTCCATTCCGTGTC
>probe:Drosophila_2:1623618_at:368:237; Interrogation_Position=1555; Antisense; AATCGGGTGTCCAAGATGGCCCAGC
>probe:Drosophila_2:1623618_at:260:367; Interrogation_Position=1581; Antisense; GAATCTTGACTTTATGGCTCCCGAA
>probe:Drosophila_2:1623618_at:68:391; Interrogation_Position=1603; Antisense; GAAACTCAGTCAACGTCCAAGTGCA
>probe:Drosophila_2:1623618_at:271:221; Interrogation_Position=1621; Antisense; AAGTGCAGCTTGCTCAGCGACATGT
>probe:Drosophila_2:1623618_at:637:229; Interrogation_Position=1656; Antisense; AATGGTGATCTGTGCGGTCTTCAAT
>probe:Drosophila_2:1623618_at:643:175; Interrogation_Position=1739; Antisense; AAACGCTGGATGATCTGGTCCACAA
>probe:Drosophila_2:1623618_at:350:215; Interrogation_Position=1762; Antisense; AAGTTGATGCCCAGACTGCCAATTG

Paste this into a BLAST search page for me
TGAAGTACGGCTTTCTCCAGCTGACAGCTGACCGAGGCACTGGCGTATCTTGGCGTATCTGCACTATTCCGGTCAATTCCGGTCACGTAATTCATCGCAATTCATCGCAATGTGTGTCCATCTTCGTATCTGGAAACTGGCCGGCATGGAGATTTGAACAGCTCCATTCCGTGTCAATCGGGTGTCCAAGATGGCCCAGCGAATCTTGACTTTATGGCTCCCGAAGAAACTCAGTCAACGTCCAAGTGCAAAGTGCAGCTTGCTCAGCGACATGTAATGGTGATCTGTGCGGTCTTCAATAAACGCTGGATGATCTGGTCCACAAAAGTTGATGCCCAGACTGCCAATTG

Full Affymetrix probeset data:

Annotations for 1623618_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720