Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623619_at:

>probe:Drosophila_2:1623619_at:240:271; Interrogation_Position=123; Antisense; CATACGCATAAACAGTGCCAAGCAG
>probe:Drosophila_2:1623619_at:715:715; Interrogation_Position=204; Antisense; TTCGATGCCCGGAACGCCGCATCAA
>probe:Drosophila_2:1623619_at:605:33; Interrogation_Position=224; Antisense; ATCAACAACCGCAGTCAAGCAGCGT
>probe:Drosophila_2:1623619_at:411:597; Interrogation_Position=338; Antisense; TGTCCATGGGCGCATCCAACCAATC
>probe:Drosophila_2:1623619_at:694:309; Interrogation_Position=353; Antisense; CCAACCAATCGCTGGGCGTGAGTGT
>probe:Drosophila_2:1623619_at:616:133; Interrogation_Position=37; Antisense; ACGCCTGTCAATAATGCACCTTCGG
>probe:Drosophila_2:1623619_at:238:313; Interrogation_Position=385; Antisense; GCCAGCAGCGTCAGCGGAATCAGCA
>probe:Drosophila_2:1623619_at:538:365; Interrogation_Position=401; Antisense; GAATCAGCATCACGCCGCCGAATAG
>probe:Drosophila_2:1623619_at:557:365; Interrogation_Position=420; Antisense; GAATAGCGCCGGACTGCGTCAGTCG
>probe:Drosophila_2:1623619_at:243:647; Interrogation_Position=438; Antisense; TCAGTCGACAGGTGAGTGGAACCCC
>probe:Drosophila_2:1623619_at:138:147; Interrogation_Position=477; Antisense; ACTCTCTGTTGTCGTGTTCTTTTCC
>probe:Drosophila_2:1623619_at:55:631; Interrogation_Position=514; Antisense; TCCTCTCTATTACTCTCTTTCAATG
>probe:Drosophila_2:1623619_at:595:145; Interrogation_Position=525; Antisense; ACTCTCTTTCAATGTCACTCATACA
>probe:Drosophila_2:1623619_at:543:495; Interrogation_Position=538; Antisense; GTCACTCATACACACTTTTCGAATT

Paste this into a BLAST search page for me
CATACGCATAAACAGTGCCAAGCAGTTCGATGCCCGGAACGCCGCATCAAATCAACAACCGCAGTCAAGCAGCGTTGTCCATGGGCGCATCCAACCAATCCCAACCAATCGCTGGGCGTGAGTGTACGCCTGTCAATAATGCACCTTCGGGCCAGCAGCGTCAGCGGAATCAGCAGAATCAGCATCACGCCGCCGAATAGGAATAGCGCCGGACTGCGTCAGTCGTCAGTCGACAGGTGAGTGGAACCCCACTCTCTGTTGTCGTGTTCTTTTCCTCCTCTCTATTACTCTCTTTCAATGACTCTCTTTCAATGTCACTCATACAGTCACTCATACACACTTTTCGAATT

Full Affymetrix probeset data:

Annotations for 1623619_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime