Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623620_a_at:

>probe:Drosophila_2:1623620_a_at:389:489; Interrogation_Position=298; Antisense; GTACTGATCTTCAAACCGGAATGGA
>probe:Drosophila_2:1623620_a_at:538:65; Interrogation_Position=318; Antisense; ATGGAACGTCGAGTACTGGCGCCTA
>probe:Drosophila_2:1623620_a_at:275:687; Interrogation_Position=349; Antisense; TATATGCTGCTCCATTCCGATTACT
>probe:Drosophila_2:1623620_a_at:715:9; Interrogation_Position=362; Antisense; ATTCCGATTACTGGCATCTGTCTCT
>probe:Drosophila_2:1623620_a_at:44:41; Interrogation_Position=377; Antisense; ATCTGTCTCTCAACATTTGCTTTCA
>probe:Drosophila_2:1623620_a_at:452:509; Interrogation_Position=402; Antisense; GTGCTTTATAGGTATCTGCCTGGAA
>probe:Drosophila_2:1623620_a_at:543:537; Interrogation_Position=540; Antisense; GGTCTACGCCATGCTGGGAAGTCAT
>probe:Drosophila_2:1623620_a_at:620:61; Interrogation_Position=563; Antisense; ATGTGCCGCACCTGGTTCTGAACTT
>probe:Drosophila_2:1623620_a_at:606:611; Interrogation_Position=581; Antisense; TGAACTTTTCGCAATTGTCGCACCG
>probe:Drosophila_2:1623620_a_at:413:315; Interrogation_Position=619; Antisense; GCCTCCCTGCTGATATTGTTACTCA
>probe:Drosophila_2:1623620_a_at:380:475; Interrogation_Position=636; Antisense; GTTACTCAGCGATGTGGGCTTTACA
>probe:Drosophila_2:1623620_a_at:591:703; Interrogation_Position=656; Antisense; TTACAACTTACCACTTTTGCCACAA
>probe:Drosophila_2:1623620_a_at:462:353; Interrogation_Position=698; Antisense; GCACCAGTCTGGAGGCGCATATTGG
>probe:Drosophila_2:1623620_a_at:145:247; Interrogation_Position=738; Antisense; AATTCTGTGCGGTTTCATCGTCTAT

Paste this into a BLAST search page for me
GTACTGATCTTCAAACCGGAATGGAATGGAACGTCGAGTACTGGCGCCTATATATGCTGCTCCATTCCGATTACTATTCCGATTACTGGCATCTGTCTCTATCTGTCTCTCAACATTTGCTTTCAGTGCTTTATAGGTATCTGCCTGGAAGGTCTACGCCATGCTGGGAAGTCATATGTGCCGCACCTGGTTCTGAACTTTGAACTTTTCGCAATTGTCGCACCGGCCTCCCTGCTGATATTGTTACTCAGTTACTCAGCGATGTGGGCTTTACATTACAACTTACCACTTTTGCCACAAGCACCAGTCTGGAGGCGCATATTGGAATTCTGTGCGGTTTCATCGTCTAT

Full Affymetrix probeset data:

Annotations for 1623620_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime