Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623622_a_at:

>probe:Drosophila_2:1623622_a_at:181:367; Interrogation_Position=281; Antisense; GAATCGCTGGACGAGTGGGACACAC
>probe:Drosophila_2:1623622_a_at:405:83; Interrogation_Position=294; Antisense; AGTGGGACACACGTGTGGACCGCAT
>probe:Drosophila_2:1623622_a_at:633:527; Interrogation_Position=297; Antisense; GGGACACACGTGTGGACCGCATCAT
>probe:Drosophila_2:1623622_a_at:315:159; Interrogation_Position=300; Antisense; ACACACGTGTGGACCGCATCATCAA
>probe:Drosophila_2:1623622_a_at:51:141; Interrogation_Position=304; Antisense; ACGTGTGGACCGCATCATCAAGCTG
>probe:Drosophila_2:1623622_a_at:673:595; Interrogation_Position=307; Antisense; TGTGGACCGCATCATCAAGCTGCCG
>probe:Drosophila_2:1623622_a_at:551:555; Interrogation_Position=310; Antisense; GGACCGCATCATCAAGCTGCCGGTG
>probe:Drosophila_2:1623622_a_at:443:117; Interrogation_Position=324; Antisense; AGCTGCCGGTGGGAAAAGCGCTAAT
>probe:Drosophila_2:1623622_a_at:651:383; Interrogation_Position=336; Antisense; GAAAAGCGCTAATAGAGAAGGACAA
>probe:Drosophila_2:1623622_a_at:638:275; Interrogation_Position=450; Antisense; CTTAGACCAGATAGCGGTAGACATG
>probe:Drosophila_2:1623622_a_at:287:265; Interrogation_Position=457; Antisense; CAGATAGCGGTAGACATGGACGACG
>probe:Drosophila_2:1623622_a_at:30:67; Interrogation_Position=472; Antisense; ATGGACGACGGAGCGAGGTGGTACC
>probe:Drosophila_2:1623622_a_at:628:501; Interrogation_Position=489; Antisense; GTGGTACCGGGAGATTTATGAGATC
>probe:Drosophila_2:1623622_a_at:491:697; Interrogation_Position=503; Antisense; TTTATGAGATCTTTGACGTGACATC

Paste this into a BLAST search page for me
GAATCGCTGGACGAGTGGGACACACAGTGGGACACACGTGTGGACCGCATGGGACACACGTGTGGACCGCATCATACACACGTGTGGACCGCATCATCAAACGTGTGGACCGCATCATCAAGCTGTGTGGACCGCATCATCAAGCTGCCGGGACCGCATCATCAAGCTGCCGGTGAGCTGCCGGTGGGAAAAGCGCTAATGAAAAGCGCTAATAGAGAAGGACAACTTAGACCAGATAGCGGTAGACATGCAGATAGCGGTAGACATGGACGACGATGGACGACGGAGCGAGGTGGTACCGTGGTACCGGGAGATTTATGAGATCTTTATGAGATCTTTGACGTGACATC

Full Affymetrix probeset data:

Annotations for 1623622_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime