Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623624_at:

>probe:Drosophila_2:1623624_at:618:503; Interrogation_Position=6392; Antisense; GTGCCAACTCCGGTATGCAGTGATG
>probe:Drosophila_2:1623624_at:472:171; Interrogation_Position=6425; Antisense; AAAGATATCCTTTGCCTAGGTAAAG
>probe:Drosophila_2:1623624_at:420:243; Interrogation_Position=6507; Antisense; AATATACTTACACTTTCCTCTGCTC
>probe:Drosophila_2:1623624_at:326:185; Interrogation_Position=6539; Antisense; AACAATTATTCCGATTATTCCCTGA
>probe:Drosophila_2:1623624_at:643:389; Interrogation_Position=6562; Antisense; GAAACAAGCCTAGGGCATCCATCCA
>probe:Drosophila_2:1623624_at:546:213; Interrogation_Position=6607; Antisense; AAGAGCTCGGCTAAACTAGTGCAAT
>probe:Drosophila_2:1623624_at:470:509; Interrogation_Position=6625; Antisense; GTGCAATGCCGGTCTGTACAATAGT
>probe:Drosophila_2:1623624_at:453:249; Interrogation_Position=6643; Antisense; CAATAGTTGTATTAGCTTAGCTCCG
>probe:Drosophila_2:1623624_at:331:341; Interrogation_Position=6657; Antisense; GCTTAGCTCCGCAATTAGTTAGTTA
>probe:Drosophila_2:1623624_at:284:451; Interrogation_Position=6757; Antisense; GATCGCACAAGCCAAACCAAACTAT
>probe:Drosophila_2:1623624_at:247:651; Interrogation_Position=6818; Antisense; TCACTGCCAGATTTTCAACGTTCAA
>probe:Drosophila_2:1623624_at:255:5; Interrogation_Position=6846; Antisense; ATTGTATCCCAAATCGCCTAAGTCC
>probe:Drosophila_2:1623624_at:208:655; Interrogation_Position=6864; Antisense; TAAGTCCCGGTACCAAGTATCCTCG
>probe:Drosophila_2:1623624_at:182:91; Interrogation_Position=6879; Antisense; AGTATCCTCGCTGTATTTTCATTTA

Paste this into a BLAST search page for me
GTGCCAACTCCGGTATGCAGTGATGAAAGATATCCTTTGCCTAGGTAAAGAATATACTTACACTTTCCTCTGCTCAACAATTATTCCGATTATTCCCTGAGAAACAAGCCTAGGGCATCCATCCAAAGAGCTCGGCTAAACTAGTGCAATGTGCAATGCCGGTCTGTACAATAGTCAATAGTTGTATTAGCTTAGCTCCGGCTTAGCTCCGCAATTAGTTAGTTAGATCGCACAAGCCAAACCAAACTATTCACTGCCAGATTTTCAACGTTCAAATTGTATCCCAAATCGCCTAAGTCCTAAGTCCCGGTACCAAGTATCCTCGAGTATCCTCGCTGTATTTTCATTTA

Full Affymetrix probeset data:

Annotations for 1623624_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime