FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623625_at:

>probe:Drosophila_2:1623625_at:602:211; Interrogation_Position=1035; Antisense; AAGAACTGGGTAGTGCTGCAATCGC
>probe:Drosophila_2:1623625_at:564:615; Interrogation_Position=1051; Antisense; TGCAATCGCACAGCCTAGCTACAAA
>probe:Drosophila_2:1623625_at:181:635; Interrogation_Position=1081; Antisense; TCGCAATACTTGTTACTTTAGAGCT
>probe:Drosophila_2:1623625_at:132:23; Interrogation_Position=1130; Antisense; ATATGTACGTTTCATGCCTGTCTTC
>probe:Drosophila_2:1623625_at:443:287; Interrogation_Position=688; Antisense; CTGGCGCTCAGAAAGCACAGGCTGT
>probe:Drosophila_2:1623625_at:702:447; Interrogation_Position=825; Antisense; GATGCCGATGCGGATCTTCAGGCGC
>probe:Drosophila_2:1623625_at:140:71; Interrogation_Position=844; Antisense; AGGCGCGCCTGGATAAGCTGCGCAA
>probe:Drosophila_2:1623625_at:577:207; Interrogation_Position=858; Antisense; AAGCTGCGCAAGGATTGAGCCGCTA
>probe:Drosophila_2:1623625_at:201:725; Interrogation_Position=872; Antisense; TTGAGCCGCTACTAAGAACCACTGC
>probe:Drosophila_2:1623625_at:498:259; Interrogation_Position=891; Antisense; CACTGCCTGTCCACTTTATGTAAGA
>probe:Drosophila_2:1623625_at:349:703; Interrogation_Position=906; Antisense; TTATGTAAGAGCCACCACCCGTTTG
>probe:Drosophila_2:1623625_at:301:305; Interrogation_Position=924; Antisense; CCGTTTGTATCTCCCAGAAGCGAAT
>probe:Drosophila_2:1623625_at:357:369; Interrogation_Position=962; Antisense; GAATGCTTGTGATTTTCGTTCCCTG
>probe:Drosophila_2:1623625_at:123:717; Interrogation_Position=976; Antisense; TTCGTTCCCTGCGTGTTTGAAAAAT

Paste this into a BLAST search page for me
AAGAACTGGGTAGTGCTGCAATCGCTGCAATCGCACAGCCTAGCTACAAATCGCAATACTTGTTACTTTAGAGCTATATGTACGTTTCATGCCTGTCTTCCTGGCGCTCAGAAAGCACAGGCTGTGATGCCGATGCGGATCTTCAGGCGCAGGCGCGCCTGGATAAGCTGCGCAAAAGCTGCGCAAGGATTGAGCCGCTATTGAGCCGCTACTAAGAACCACTGCCACTGCCTGTCCACTTTATGTAAGATTATGTAAGAGCCACCACCCGTTTGCCGTTTGTATCTCCCAGAAGCGAATGAATGCTTGTGATTTTCGTTCCCTGTTCGTTCCCTGCGTGTTTGAAAAAT

Full Affymetrix probeset data:

Annotations for 1623625_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720