Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623626_a_at:

>probe:Drosophila_2:1623626_a_at:235:489; Interrogation_Position=1821; Antisense; GTACGAGCAACATCTGCTACATATG
>probe:Drosophila_2:1623626_a_at:249:419; Interrogation_Position=1858; Antisense; GAGCAGCACACAACGGACCCGAAAT
>probe:Drosophila_2:1623626_a_at:235:547; Interrogation_Position=1898; Antisense; GGAGGCAATTTTGTATGCAATACGT
>probe:Drosophila_2:1623626_a_at:397:267; Interrogation_Position=2047; Antisense; CATCGACGCCCATTTACAAAGCTAT
>probe:Drosophila_2:1623626_a_at:242:327; Interrogation_Position=2109; Antisense; GCGATGATCGCGCAAGTCGAACGAT
>probe:Drosophila_2:1623626_a_at:699:295; Interrogation_Position=2126; Antisense; CGAACGATAAACTCGATCATGTATA
>probe:Drosophila_2:1623626_a_at:166:729; Interrogation_Position=2166; Antisense; TTGGAACCAAGAGCTGAGAACAGAC
>probe:Drosophila_2:1623626_a_at:632:353; Interrogation_Position=2201; Antisense; GCAGCCTCATATGCATACTTGTATA
>probe:Drosophila_2:1623626_a_at:337:157; Interrogation_Position=2225; Antisense; ACAAACCTTCAATGGGTGGATGGCG
>probe:Drosophila_2:1623626_a_at:394:591; Interrogation_Position=2251; Antisense; TGGTCCTCGCGGCTAAGAAAACTCG
>probe:Drosophila_2:1623626_a_at:442:389; Interrogation_Position=2267; Antisense; GAAAACTCGCCATCTGGTCTTAAGT
>probe:Drosophila_2:1623626_a_at:34:499; Interrogation_Position=2283; Antisense; GTCTTAAGTAACCTCTCTGTGCTCT
>probe:Drosophila_2:1623626_a_at:153:621; Interrogation_Position=2302; Antisense; TGCTCTCCAGAAACACGTAACACGT
>probe:Drosophila_2:1623626_a_at:118:519; Interrogation_Position=2345; Antisense; GTGGTGGATCCCGAGTAACATTGAA

Paste this into a BLAST search page for me
GTACGAGCAACATCTGCTACATATGGAGCAGCACACAACGGACCCGAAATGGAGGCAATTTTGTATGCAATACGTCATCGACGCCCATTTACAAAGCTATGCGATGATCGCGCAAGTCGAACGATCGAACGATAAACTCGATCATGTATATTGGAACCAAGAGCTGAGAACAGACGCAGCCTCATATGCATACTTGTATAACAAACCTTCAATGGGTGGATGGCGTGGTCCTCGCGGCTAAGAAAACTCGGAAAACTCGCCATCTGGTCTTAAGTGTCTTAAGTAACCTCTCTGTGCTCTTGCTCTCCAGAAACACGTAACACGTGTGGTGGATCCCGAGTAACATTGAA

Full Affymetrix probeset data:

Annotations for 1623626_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime