FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623628_at:

>probe:Drosophila_2:1623628_at:134:341; Interrogation_Position=1059; Antisense; GTTGCAACTAGCTCGAAACCCATTA
>probe:Drosophila_2:1623628_at:632:229; Interrogation_Position=1095; Antisense; AATGGGTATGTTCCCTATCACGCGT
>probe:Drosophila_2:1623628_at:83:145; Interrogation_Position=1126; Antisense; ACTGCGGCTATGTGTGCTTCTGTTA
>probe:Drosophila_2:1623628_at:601:91; Interrogation_Position=643; Antisense; AGTTTCCTGCAGCTCCGAAATGGAG
>probe:Drosophila_2:1623628_at:393:427; Interrogation_Position=678; Antisense; GAGATGCTGCTATCTATCTGATCAG
>probe:Drosophila_2:1623628_at:190:531; Interrogation_Position=715; Antisense; GGTGAGGTTCAGAGCCAACTACAAT
>probe:Drosophila_2:1623628_at:104:513; Interrogation_Position=794; Antisense; GTGAGTACTACCTATCCATTGTGGG
>probe:Drosophila_2:1623628_at:513:517; Interrogation_Position=814; Antisense; GTGGGTACATCTTACATGTCGTATA
>probe:Drosophila_2:1623628_at:366:681; Interrogation_Position=850; Antisense; TATGGCCCGCATAATCTGAAACTAT
>probe:Drosophila_2:1623628_at:124:599; Interrogation_Position=894; Antisense; TGTCTGCATTTTGATAACCCTATTT
>probe:Drosophila_2:1623628_at:154:201; Interrogation_Position=909; Antisense; AACCCTATTTTACCTTGATGCCTTG
>probe:Drosophila_2:1623628_at:394:275; Interrogation_Position=922; Antisense; CTTGATGCCTTGGTCAACTGCAACA
>probe:Drosophila_2:1623628_at:221:25; Interrogation_Position=947; Antisense; ATATGCTACGTGTGTTGGACCATCA
>probe:Drosophila_2:1623628_at:700:381; Interrogation_Position=997; Antisense; GAACGAACTGTGTTTGCTTCCAGCT

Paste this into a BLAST search page for me
GTTGCAACTAGCTCGAAACCCATTAAATGGGTATGTTCCCTATCACGCGTACTGCGGCTATGTGTGCTTCTGTTAAGTTTCCTGCAGCTCCGAAATGGAGGAGATGCTGCTATCTATCTGATCAGGGTGAGGTTCAGAGCCAACTACAATGTGAGTACTACCTATCCATTGTGGGGTGGGTACATCTTACATGTCGTATATATGGCCCGCATAATCTGAAACTATTGTCTGCATTTTGATAACCCTATTTAACCCTATTTTACCTTGATGCCTTGCTTGATGCCTTGGTCAACTGCAACAATATGCTACGTGTGTTGGACCATCAGAACGAACTGTGTTTGCTTCCAGCT

Full Affymetrix probeset data:

Annotations for 1623628_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720