Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623631_at:

>probe:Drosophila_2:1623631_at:601:227; Interrogation_Position=1178; Antisense; AAGGCGAAGTCTCAGTTCAAGCGAA
>probe:Drosophila_2:1623631_at:237:519; Interrogation_Position=1220; Antisense; GTGGAAATCGTCATACCAGTGCCCG
>probe:Drosophila_2:1623631_at:463:411; Interrogation_Position=1247; Antisense; GACGCGGACTCACCCAAGTTCAAGA
>probe:Drosophila_2:1623631_at:618:377; Interrogation_Position=1281; Antisense; GAAGCTGCAAGTACGCACCGGAGCA
>probe:Drosophila_2:1623631_at:527:451; Interrogation_Position=1324; Antisense; GATCAAATCGTTCCCGGGTGGCAAG
>probe:Drosophila_2:1623631_at:278:251; Interrogation_Position=1345; Antisense; CAAGGAGTATCTAATGCGGGCACAT
>probe:Drosophila_2:1623631_at:271:151; Interrogation_Position=1366; Antisense; ACATTTCGGTCTGCCGAGCGTGGAA
>probe:Drosophila_2:1623631_at:398:29; Interrogation_Position=1401; Antisense; ATACGGAGGGCAAGCCGCCAATTCA
>probe:Drosophila_2:1623631_at:716:243; Interrogation_Position=1420; Antisense; AATTCAGGTGCGCTTCGAGATTCCC
>probe:Drosophila_2:1623631_at:414:523; Interrogation_Position=1459; Antisense; GGGCATCCAGGTGCGCTATCTGAAG
>probe:Drosophila_2:1623631_at:338:213; Interrogation_Position=1493; Antisense; AAGAGCGGCTATCAGGCGCTGCCAT
>probe:Drosophila_2:1623631_at:71:405; Interrogation_Position=1544; Antisense; GACTATCAGCTACGCACCAATTGAA
>probe:Drosophila_2:1623631_at:244:649; Interrogation_Position=1607; Antisense; TCAGCGAGTCATCCTGCAACAGGTA
>probe:Drosophila_2:1623631_at:623:701; Interrogation_Position=1651; Antisense; TTTTGTCTGCGATGCGTTGCGTTAA

Paste this into a BLAST search page for me
AAGGCGAAGTCTCAGTTCAAGCGAAGTGGAAATCGTCATACCAGTGCCCGGACGCGGACTCACCCAAGTTCAAGAGAAGCTGCAAGTACGCACCGGAGCAGATCAAATCGTTCCCGGGTGGCAAGCAAGGAGTATCTAATGCGGGCACATACATTTCGGTCTGCCGAGCGTGGAAATACGGAGGGCAAGCCGCCAATTCAAATTCAGGTGCGCTTCGAGATTCCCGGGCATCCAGGTGCGCTATCTGAAGAAGAGCGGCTATCAGGCGCTGCCATGACTATCAGCTACGCACCAATTGAATCAGCGAGTCATCCTGCAACAGGTATTTTGTCTGCGATGCGTTGCGTTAA

Full Affymetrix probeset data:

Annotations for 1623631_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime