FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623633_at:

>probe:Drosophila_2:1623633_at:13:597; Interrogation_Position=1003; Antisense; TGTGTTCAACCTCGCCAGAGGAGCA
>probe:Drosophila_2:1623633_at:654:363; Interrogation_Position=1032; Antisense; GAATCTTTGAACGACCACTTAGTAC
>probe:Drosophila_2:1623633_at:470:367; Interrogation_Position=539; Antisense; GAATCGGACAAACTACTCTCGCTGA
>probe:Drosophila_2:1623633_at:351:641; Interrogation_Position=555; Antisense; TCTCGCTGATATCACGCAAGCCGGG
>probe:Drosophila_2:1623633_at:203:297; Interrogation_Position=599; Antisense; CGCTACTCCTGCGAAGTCAGCAAAA
>probe:Drosophila_2:1623633_at:382:175; Interrogation_Position=621; Antisense; AAACCCAGTTCAAGGTGACGCCGCT
>probe:Drosophila_2:1623633_at:452:553; Interrogation_Position=697; Antisense; GGAGCAGACCACAGAGCCGGCCAGC
>probe:Drosophila_2:1623633_at:5:353; Interrogation_Position=720; Antisense; GCAGCACCTTCAAAATCGAGCTTGA
>probe:Drosophila_2:1623633_at:518:547; Interrogation_Position=748; Antisense; GGATGAAGTGTTGGCCCGCAATGCA
>probe:Drosophila_2:1623633_at:471:151; Interrogation_Position=794; Antisense; ACATCCGAGCCGTCTGAGGGAAACA
>probe:Drosophila_2:1623633_at:84:191; Interrogation_Position=815; Antisense; AACATAATATACACGCCCGATGCCG
>probe:Drosophila_2:1623633_at:540:435; Interrogation_Position=869; Antisense; GAGGATCTGTGCATCTAGGCTGCCC
>probe:Drosophila_2:1623633_at:533:25; Interrogation_Position=917; Antisense; ATAGCCTTGGCTTTAAGTCTCCTTA
>probe:Drosophila_2:1623633_at:100:655; Interrogation_Position=930; Antisense; TAAGTCTCCTTAAGTCTAACCTACT

Paste this into a BLAST search page for me
TGTGTTCAACCTCGCCAGAGGAGCAGAATCTTTGAACGACCACTTAGTACGAATCGGACAAACTACTCTCGCTGATCTCGCTGATATCACGCAAGCCGGGCGCTACTCCTGCGAAGTCAGCAAAAAAACCCAGTTCAAGGTGACGCCGCTGGAGCAGACCACAGAGCCGGCCAGCGCAGCACCTTCAAAATCGAGCTTGAGGATGAAGTGTTGGCCCGCAATGCAACATCCGAGCCGTCTGAGGGAAACAAACATAATATACACGCCCGATGCCGGAGGATCTGTGCATCTAGGCTGCCCATAGCCTTGGCTTTAAGTCTCCTTATAAGTCTCCTTAAGTCTAACCTACT

Full Affymetrix probeset data:

Annotations for 1623633_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720