FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623634_at:

>probe:Drosophila_2:1623634_at:99:85; Interrogation_Position=388; Antisense; AGTGGTCGTTTGCATGGTTTCACCC
>probe:Drosophila_2:1623634_at:12:541; Interrogation_Position=403; Antisense; GGTTTCACCCATCAATGCTGTGGAC
>probe:Drosophila_2:1623634_at:138:621; Interrogation_Position=418; Antisense; TGCTGTGGACTTCGAGATGACCGCC
>probe:Drosophila_2:1623634_at:702:275; Interrogation_Position=445; Antisense; CTTCTGGCGTCACAATATCTGCTAC
>probe:Drosophila_2:1623634_at:440:481; Interrogation_Position=477; Antisense; GTATCGAGAAGCACCAACTCACCTG
>probe:Drosophila_2:1623634_at:93:317; Interrogation_Position=559; Antisense; GCCGGAGGATCTAAGGTTTCGCCAG
>probe:Drosophila_2:1623634_at:721:529; Interrogation_Position=584; Antisense; GGGTTATTCCCATCATTTTGCAGTA
>probe:Drosophila_2:1623634_at:434:273; Interrogation_Position=597; Antisense; CATTTTGCAGTATTCGCACTCCGAG
>probe:Drosophila_2:1623634_at:64:357; Interrogation_Position=612; Antisense; GCACTCCGAGCAAGTACTGGCGATA
>probe:Drosophila_2:1623634_at:239:139; Interrogation_Position=627; Antisense; ACTGGCGATAGTTTTCGACCGGAGA
>probe:Drosophila_2:1623634_at:378:441; Interrogation_Position=650; Antisense; GATGGGATGCGGCATTTTCACCCTT
>probe:Drosophila_2:1623634_at:254:589; Interrogation_Position=688; Antisense; TGGAGTGTCAATTATCCCGCCCGAG
>probe:Drosophila_2:1623634_at:473:419; Interrogation_Position=710; Antisense; GAGCATTTTGCCCTAATGGCTGCAA
>probe:Drosophila_2:1623634_at:705:457; Interrogation_Position=742; Antisense; GTAATTGGTTAGCAGCCCTACCTTG

Paste this into a BLAST search page for me
AGTGGTCGTTTGCATGGTTTCACCCGGTTTCACCCATCAATGCTGTGGACTGCTGTGGACTTCGAGATGACCGCCCTTCTGGCGTCACAATATCTGCTACGTATCGAGAAGCACCAACTCACCTGGCCGGAGGATCTAAGGTTTCGCCAGGGGTTATTCCCATCATTTTGCAGTACATTTTGCAGTATTCGCACTCCGAGGCACTCCGAGCAAGTACTGGCGATAACTGGCGATAGTTTTCGACCGGAGAGATGGGATGCGGCATTTTCACCCTTTGGAGTGTCAATTATCCCGCCCGAGGAGCATTTTGCCCTAATGGCTGCAAGTAATTGGTTAGCAGCCCTACCTTG

Full Affymetrix probeset data:

Annotations for 1623634_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720