FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623635_at:

>probe:Drosophila_2:1623635_at:454:463; Interrogation_Position=169; Antisense; GATTCTTCGGTTGATGAGGCCACCA
>probe:Drosophila_2:1623635_at:626:159; Interrogation_Position=193; Antisense; AAATACCGGAACATCGACAGCCTGG
>probe:Drosophila_2:1623635_at:224:155; Interrogation_Position=209; Antisense; ACAGCCTGGTCACTTTCTACGATAA
>probe:Drosophila_2:1623635_at:606:217; Interrogation_Position=232; Antisense; AAGTACTTCACTCGACTTCAGTTGA
>probe:Drosophila_2:1623635_at:617:611; Interrogation_Position=254; Antisense; TGAAACCGGACTTGAACACACGCGC
>probe:Drosophila_2:1623635_at:420:321; Interrogation_Position=277; Antisense; GCCCATGATCTCTTGAGGCGTTACA
>probe:Drosophila_2:1623635_at:494:253; Interrogation_Position=34; Antisense; CAAGCCTGCACTATGAATCCTACAA
>probe:Drosophila_2:1623635_at:405:463; Interrogation_Position=353; Antisense; GATTCTGGTTGCCACTGGTGAAGCT
>probe:Drosophila_2:1623635_at:106:511; Interrogation_Position=370; Antisense; GTGAAGCTACTCATTGTCCAGCTGG
>probe:Drosophila_2:1623635_at:167:317; Interrogation_Position=406; Antisense; GCCTCTGAGGGAGTCAAGCGTGCTA
>probe:Drosophila_2:1623635_at:602:327; Interrogation_Position=423; Antisense; GCGTGCTATTGAATCCTAATCCCTT
>probe:Drosophila_2:1623635_at:357:667; Interrogation_Position=530; Antisense; TACTTTCCAACCCATTCCAATAAAT
>probe:Drosophila_2:1623635_at:57:689; Interrogation_Position=61; Antisense; TATTTGAGCTGCCTTATGGTCTTCT
>probe:Drosophila_2:1623635_at:547:497; Interrogation_Position=79; Antisense; GTCTTCTCAGTGTTTCTGCTGGGAA

Paste this into a BLAST search page for me
GATTCTTCGGTTGATGAGGCCACCAAAATACCGGAACATCGACAGCCTGGACAGCCTGGTCACTTTCTACGATAAAAGTACTTCACTCGACTTCAGTTGATGAAACCGGACTTGAACACACGCGCGCCCATGATCTCTTGAGGCGTTACACAAGCCTGCACTATGAATCCTACAAGATTCTGGTTGCCACTGGTGAAGCTGTGAAGCTACTCATTGTCCAGCTGGGCCTCTGAGGGAGTCAAGCGTGCTAGCGTGCTATTGAATCCTAATCCCTTTACTTTCCAACCCATTCCAATAAATTATTTGAGCTGCCTTATGGTCTTCTGTCTTCTCAGTGTTTCTGCTGGGAA

Full Affymetrix probeset data:

Annotations for 1623635_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720