FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623636_at:

>probe:Drosophila_2:1623636_at:387:231; Interrogation_Position=276; Antisense; AATGATGCAGGCAGTACCTGGAGTC
>probe:Drosophila_2:1623636_at:14:349; Interrogation_Position=282; Antisense; GCAGGCAGTACCTGGAGTCGACCCT
>probe:Drosophila_2:1623636_at:316:715; Interrogation_Position=461; Antisense; TTCGTGTTTCCCTAGGCTTTCCATC
>probe:Drosophila_2:1623636_at:643:679; Interrogation_Position=473; Antisense; TAGGCTTTCCATCCGAGGCTGCCAA
>probe:Drosophila_2:1623636_at:392:719; Interrogation_Position=479; Antisense; TTCCATCCGAGGCTGCCAATGCGAT
>probe:Drosophila_2:1623636_at:239:295; Interrogation_Position=486; Antisense; CGAGGCTGCCAATGCGATACCAGAT
>probe:Drosophila_2:1623636_at:719:335; Interrogation_Position=490; Antisense; GCTGCCAATGCGATACCAGATGCGT
>probe:Drosophila_2:1623636_at:414:233; Interrogation_Position=496; Antisense; AATGCGATACCAGATGCGTCACACT
>probe:Drosophila_2:1623636_at:190:327; Interrogation_Position=499; Antisense; GCGATACCAGATGCGTCACACTTTG
>probe:Drosophila_2:1623636_at:637:27; Interrogation_Position=502; Antisense; ATACCAGATGCGTCACACTTTGGCA
>probe:Drosophila_2:1623636_at:380:447; Interrogation_Position=508; Antisense; GATGCGTCACACTTTGGCATTCGGA
>probe:Drosophila_2:1623636_at:519:327; Interrogation_Position=511; Antisense; GCGTCACACTTTGGCATTCGGAACA
>probe:Drosophila_2:1623636_at:721:493; Interrogation_Position=513; Antisense; GTCACACTTTGGCATTCGGAACAGG
>probe:Drosophila_2:1623636_at:602:157; Interrogation_Position=516; Antisense; ACACTTTGGCATTCGGAACAGGTGA

Paste this into a BLAST search page for me
AATGATGCAGGCAGTACCTGGAGTCGCAGGCAGTACCTGGAGTCGACCCTTTCGTGTTTCCCTAGGCTTTCCATCTAGGCTTTCCATCCGAGGCTGCCAATTCCATCCGAGGCTGCCAATGCGATCGAGGCTGCCAATGCGATACCAGATGCTGCCAATGCGATACCAGATGCGTAATGCGATACCAGATGCGTCACACTGCGATACCAGATGCGTCACACTTTGATACCAGATGCGTCACACTTTGGCAGATGCGTCACACTTTGGCATTCGGAGCGTCACACTTTGGCATTCGGAACAGTCACACTTTGGCATTCGGAACAGGACACTTTGGCATTCGGAACAGGTGA

Full Affymetrix probeset data:

Annotations for 1623636_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720