Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623637_s_at:

>probe:Drosophila_2:1623637_s_at:564:309; Interrogation_Position=116; Antisense; CCAACCTTGCCGAGATCGTGAGGCA
>probe:Drosophila_2:1623637_s_at:523:97; Interrogation_Position=128; Antisense; AGATCGTGAGGCAGGTCTCCGATGT
>probe:Drosophila_2:1623637_s_at:716:79; Interrogation_Position=140; Antisense; AGGTCTCCGATGTTGAGCCCGAGAA
>probe:Drosophila_2:1623637_s_at:62:603; Interrogation_Position=150; Antisense; TGTTGAGCCCGAGAAGTGGAGCTCC
>probe:Drosophila_2:1623637_s_at:446:117; Interrogation_Position=169; Antisense; AGCTCCGACGTGGAGACCAGCGATG
>probe:Drosophila_2:1623637_s_at:564:121; Interrogation_Position=187; Antisense; AGCGATGGCACCAGCATCAAACAGG
>probe:Drosophila_2:1623637_s_at:51:117; Interrogation_Position=199; Antisense; AGCATCAAACAGGAGGGTGTCCTCA
>probe:Drosophila_2:1623637_s_at:412:435; Interrogation_Position=211; Antisense; GAGGGTGTCCTCAAGAACGCTGGCA
>probe:Drosophila_2:1623637_s_at:187:211; Interrogation_Position=223; Antisense; AAGAACGCTGGCACTGACAACGAGG
>probe:Drosophila_2:1623637_s_at:143:585; Interrogation_Position=231; Antisense; TGGCACTGACAACGAGGCCGCTGTC
>probe:Drosophila_2:1623637_s_at:226:199; Interrogation_Position=241; Antisense; AACGAGGCCGCTGTCGTCCACGGAT
>probe:Drosophila_2:1623637_s_at:384:141; Interrogation_Position=260; Antisense; ACGGATCCTTCACCTGGGTGGATGA
>probe:Drosophila_2:1623637_s_at:326:375; Interrogation_Position=285; Antisense; GAAGACCGGCGAGAAGTTCACCATC
>probe:Drosophila_2:1623637_s_at:641:471; Interrogation_Position=300; Antisense; GTTCACCATCACATACGTGGCTGAT

Paste this into a BLAST search page for me
CCAACCTTGCCGAGATCGTGAGGCAAGATCGTGAGGCAGGTCTCCGATGTAGGTCTCCGATGTTGAGCCCGAGAATGTTGAGCCCGAGAAGTGGAGCTCCAGCTCCGACGTGGAGACCAGCGATGAGCGATGGCACCAGCATCAAACAGGAGCATCAAACAGGAGGGTGTCCTCAGAGGGTGTCCTCAAGAACGCTGGCAAAGAACGCTGGCACTGACAACGAGGTGGCACTGACAACGAGGCCGCTGTCAACGAGGCCGCTGTCGTCCACGGATACGGATCCTTCACCTGGGTGGATGAGAAGACCGGCGAGAAGTTCACCATCGTTCACCATCACATACGTGGCTGAT

Full Affymetrix probeset data:

Annotations for 1623637_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime