Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623638_a_at:

>probe:Drosophila_2:1623638_a_at:569:671; Interrogation_Position=173; Antisense; TACGCGGCCGCCGAGCAGGAAGATC
>probe:Drosophila_2:1623638_a_at:545:563; Interrogation_Position=190; Antisense; GGAAGATCCAGACCCAGACCAGGAG
>probe:Drosophila_2:1623638_a_at:229:565; Interrogation_Position=229; Antisense; GGAATCGCCCATTGGTTCGTTGGAG
>probe:Drosophila_2:1623638_a_at:433:285; Interrogation_Position=266; Antisense; CTGAGCAGTCGCAAGCGGCAGCTGA
>probe:Drosophila_2:1623638_a_at:394:353; Interrogation_Position=283; Antisense; GCAGCTGAGTCGCTTTCATCCATAC
>probe:Drosophila_2:1623638_a_at:529:25; Interrogation_Position=304; Antisense; ATACCACGGGTCCAATATCCAGTTG
>probe:Drosophila_2:1623638_a_at:254:249; Interrogation_Position=316; Antisense; CAATATCCAGTTGGGCGACGACGCC
>probe:Drosophila_2:1623638_a_at:60:259; Interrogation_Position=340; Antisense; CACAGTGGCCTACCGGAGAGCTAGT
>probe:Drosophila_2:1623638_a_at:684:425; Interrogation_Position=355; Antisense; GAGAGCTAGTTTTGCCGACGCCCTG
>probe:Drosophila_2:1623638_a_at:72:559; Interrogation_Position=409; Antisense; GGACATCTTCTTGGTGGAGATCGAA
>probe:Drosophila_2:1623638_a_at:145:579; Interrogation_Position=449; Antisense; TGGTCGGGCCATATGCGTCTTGGTC
>probe:Drosophila_2:1623638_a_at:501:51; Interrogation_Position=461; Antisense; ATGCGTCTTGGTCTCACCGAACTAG
>probe:Drosophila_2:1623638_a_at:99:385; Interrogation_Position=479; Antisense; GAACTAGCGCCCAATGTGATTCGCA
>probe:Drosophila_2:1623638_a_at:79:515; Interrogation_Position=494; Antisense; GTGATTCGCACCAGCAGCGAGGGAA

Paste this into a BLAST search page for me
TACGCGGCCGCCGAGCAGGAAGATCGGAAGATCCAGACCCAGACCAGGAGGGAATCGCCCATTGGTTCGTTGGAGCTGAGCAGTCGCAAGCGGCAGCTGAGCAGCTGAGTCGCTTTCATCCATACATACCACGGGTCCAATATCCAGTTGCAATATCCAGTTGGGCGACGACGCCCACAGTGGCCTACCGGAGAGCTAGTGAGAGCTAGTTTTGCCGACGCCCTGGGACATCTTCTTGGTGGAGATCGAATGGTCGGGCCATATGCGTCTTGGTCATGCGTCTTGGTCTCACCGAACTAGGAACTAGCGCCCAATGTGATTCGCAGTGATTCGCACCAGCAGCGAGGGAA

Full Affymetrix probeset data:

Annotations for 1623638_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime