Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623640_at:

>probe:Drosophila_2:1623640_at:442:419; Interrogation_Position=123; Antisense; GAGCTTACGCGATTACTTCGGACGT
>probe:Drosophila_2:1623640_at:487:475; Interrogation_Position=146; Antisense; GTTACGGTGATATCTCAGAGGCTAT
>probe:Drosophila_2:1623640_at:339:55; Interrogation_Position=175; Antisense; ATGAAGGATCCCACGACGCGCAGAT
>probe:Drosophila_2:1623640_at:293:409; Interrogation_Position=189; Antisense; GACGCGCAGATCCAGAATTCCTGAG
>probe:Drosophila_2:1623640_at:116:65; Interrogation_Position=26; Antisense; ATGGGTTGTATTCCGCGAGTATGCA
>probe:Drosophila_2:1623640_at:40:161; Interrogation_Position=297; Antisense; ACAAGCTGCACGCAAAGTTGCCGCA
>probe:Drosophila_2:1623640_at:332:723; Interrogation_Position=314; Antisense; TTGCCGCAGCGATAGTCAACAGTGT
>probe:Drosophila_2:1623640_at:288:589; Interrogation_Position=338; Antisense; TGGTTAATAAATATGCGGCCCGGTC
>probe:Drosophila_2:1623640_at:240:79; Interrogation_Position=378; Antisense; AGGATACGCCACCAGGATCAGCCAT
>probe:Drosophila_2:1623640_at:325:419; Interrogation_Position=393; Antisense; GATCAGCCATCAGCAGGCATTGCAT
>probe:Drosophila_2:1623640_at:655:569; Interrogation_Position=408; Antisense; GGCATTGCATACTTATGGGCCACCT
>probe:Drosophila_2:1623640_at:74:633; Interrogation_Position=432; Antisense; TCCGCTAACTGGTTACACGGCGAAA
>probe:Drosophila_2:1623640_at:149:365; Interrogation_Position=54; Antisense; GAATAATGTCCAGTTGCGTATGCAA
>probe:Drosophila_2:1623640_at:421:685; Interrogation_Position=97; Antisense; TATTTAGGGAGATCCTCGGCCAGGA

Paste this into a BLAST search page for me
GAGCTTACGCGATTACTTCGGACGTGTTACGGTGATATCTCAGAGGCTATATGAAGGATCCCACGACGCGCAGATGACGCGCAGATCCAGAATTCCTGAGATGGGTTGTATTCCGCGAGTATGCAACAAGCTGCACGCAAAGTTGCCGCATTGCCGCAGCGATAGTCAACAGTGTTGGTTAATAAATATGCGGCCCGGTCAGGATACGCCACCAGGATCAGCCATGATCAGCCATCAGCAGGCATTGCATGGCATTGCATACTTATGGGCCACCTTCCGCTAACTGGTTACACGGCGAAAGAATAATGTCCAGTTGCGTATGCAATATTTAGGGAGATCCTCGGCCAGGA

Full Affymetrix probeset data:

Annotations for 1623640_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime