FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623641_at:

>probe:Drosophila_2:1623641_at:387:621; Interrogation_Position=14; Antisense; TGCTGCAAACAAATCGAGTCCTTCA
>probe:Drosophila_2:1623641_at:713:651; Interrogation_Position=140; Antisense; TCAAGTCTCAGGTGGTGGGCCAGCA
>probe:Drosophila_2:1623641_at:114:181; Interrogation_Position=171; Antisense; AAAAACGCAGTGCTCCCCTGGAAGG
>probe:Drosophila_2:1623641_at:258:223; Interrogation_Position=192; Antisense; AAGGGATCCCCTCCACATAGATCTG
>probe:Drosophila_2:1623641_at:705:95; Interrogation_Position=210; Antisense; AGATCTGTCGGTGGAGCAGTCCCCA
>probe:Drosophila_2:1623641_at:705:113; Interrogation_Position=224; Antisense; AGCAGTCCCCAATCACAACTGTGAT
>probe:Drosophila_2:1623641_at:626:511; Interrogation_Position=244; Antisense; GTGATGGAGTCCCATCTCGTCAACA
>probe:Drosophila_2:1623641_at:9:677; Interrogation_Position=278; Antisense; TAGATCTGGATCTCGTAAGCCAAAT
>probe:Drosophila_2:1623641_at:590:431; Interrogation_Position=29; Antisense; GAGTCCTTCAAAAAGAGCAGGCTGA
>probe:Drosophila_2:1623641_at:80:657; Interrogation_Position=293; Antisense; TAAGCCAAATGAGGCGTTTCGAGGA
>probe:Drosophila_2:1623641_at:164:373; Interrogation_Position=319; Antisense; GAAGTCGACTCGGATTAAAATTGTT
>probe:Drosophila_2:1623641_at:255:349; Interrogation_Position=45; Antisense; GCAGGCTGAACTATTTGCTATCCAG
>probe:Drosophila_2:1623641_at:522:341; Interrogation_Position=61; Antisense; GCTATCCAGAAGAAACTCGACCGAG
>probe:Drosophila_2:1623641_at:118:303; Interrogation_Position=90; Antisense; CCCCGTCATTCAGGAGGCATTAAAT

Paste this into a BLAST search page for me
TGCTGCAAACAAATCGAGTCCTTCATCAAGTCTCAGGTGGTGGGCCAGCAAAAAACGCAGTGCTCCCCTGGAAGGAAGGGATCCCCTCCACATAGATCTGAGATCTGTCGGTGGAGCAGTCCCCAAGCAGTCCCCAATCACAACTGTGATGTGATGGAGTCCCATCTCGTCAACATAGATCTGGATCTCGTAAGCCAAATGAGTCCTTCAAAAAGAGCAGGCTGATAAGCCAAATGAGGCGTTTCGAGGAGAAGTCGACTCGGATTAAAATTGTTGCAGGCTGAACTATTTGCTATCCAGGCTATCCAGAAGAAACTCGACCGAGCCCCGTCATTCAGGAGGCATTAAAT

Full Affymetrix probeset data:

Annotations for 1623641_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720