Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623642_at:

>probe:Drosophila_2:1623642_at:574:21; Interrogation_Position=1447; Antisense; ATAGGCGGTCTGCATTCACTTTGGA
>probe:Drosophila_2:1623642_at:598:85; Interrogation_Position=1490; Antisense; AGTCGCCAGAGGTAATAACGCTTAT
>probe:Drosophila_2:1623642_at:293:343; Interrogation_Position=1509; Antisense; GCTTATCGCTTCTGATTTGCCATAT
>probe:Drosophila_2:1623642_at:139:185; Interrogation_Position=1534; Antisense; AAAATCACGGTCGATTCCCTCAATG
>probe:Drosophila_2:1623642_at:139:603; Interrogation_Position=1607; Antisense; TGTTCTACGGACTGGTGGCCACCTG
>probe:Drosophila_2:1623642_at:286:261; Interrogation_Position=1626; Antisense; CACCTGTGCCTTGGAGCTTACGGAT
>probe:Drosophila_2:1623642_at:107:417; Interrogation_Position=1639; Antisense; GAGCTTACGGATCCTGATGTTTCGA
>probe:Drosophila_2:1623642_at:234:667; Interrogation_Position=1675; Antisense; TACATAAGTCAGTTGCGGCCATTAG
>probe:Drosophila_2:1623642_at:430:563; Interrogation_Position=1704; Antisense; GGAATTCGCGGAGTTCTTCAAAAAT
>probe:Drosophila_2:1623642_at:180:595; Interrogation_Position=1745; Antisense; TGGGCGTATCCGACTCCAAGTTGGC
>probe:Drosophila_2:1623642_at:158:539; Interrogation_Position=1867; Antisense; GGTTCTATTCCCAACGGACTTCTGA
>probe:Drosophila_2:1623642_at:577:555; Interrogation_Position=1882; Antisense; GGACTTCTGACTGGCAATTTATTCG
>probe:Drosophila_2:1623642_at:138:493; Interrogation_Position=1913; Antisense; GTAACTTTGATGAATGCCTTTCCAT
>probe:Drosophila_2:1623642_at:652:713; Interrogation_Position=1975; Antisense; TTCATGCTCGTCCACGCAAATGGAA

Paste this into a BLAST search page for me
ATAGGCGGTCTGCATTCACTTTGGAAGTCGCCAGAGGTAATAACGCTTATGCTTATCGCTTCTGATTTGCCATATAAAATCACGGTCGATTCCCTCAATGTGTTCTACGGACTGGTGGCCACCTGCACCTGTGCCTTGGAGCTTACGGATGAGCTTACGGATCCTGATGTTTCGATACATAAGTCAGTTGCGGCCATTAGGGAATTCGCGGAGTTCTTCAAAAATTGGGCGTATCCGACTCCAAGTTGGCGGTTCTATTCCCAACGGACTTCTGAGGACTTCTGACTGGCAATTTATTCGGTAACTTTGATGAATGCCTTTCCATTTCATGCTCGTCCACGCAAATGGAA

Full Affymetrix probeset data:

Annotations for 1623642_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime