Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623644_s_at:

>probe:Drosophila_2:1623644_s_at:82:109; Interrogation_Position=105; Antisense; AGAATGTTGATCTGTACGTGCCCCG
>probe:Drosophila_2:1623644_s_at:207:167; Interrogation_Position=131; Antisense; AAATGCTCGGCGTCCAACAGGATCA
>probe:Drosophila_2:1623644_s_at:159:189; Interrogation_Position=146; Antisense; AACAGGATCATCCACGCCAAGGATC
>probe:Drosophila_2:1623644_s_at:292:631; Interrogation_Position=176; Antisense; TCCGTGCAGCTGAGCATCGTGGATG
>probe:Drosophila_2:1623644_s_at:421:41; Interrogation_Position=191; Antisense; ATCGTGGATGTGGACCCCGAGACCG
>probe:Drosophila_2:1623644_s_at:300:213; Interrogation_Position=236; Antisense; AAGACCTACGCCATCTGCGGCGAGA
>probe:Drosophila_2:1623644_s_at:502:97; Interrogation_Position=258; Antisense; AGATCCGTCGCATGGGCGAGTCCGA
>probe:Drosophila_2:1623644_s_at:622:143; Interrogation_Position=285; Antisense; ACTGCATCGTGCGTCTGGCCAAGAA
>probe:Drosophila_2:1623644_s_at:253:557; Interrogation_Position=310; Antisense; GGACGGCATCATTACCAAGAACTTC
>probe:Drosophila_2:1623644_s_at:474:251; Interrogation_Position=325; Antisense; CAAGAACTTCTAAGCGTGGCGTACC
>probe:Drosophila_2:1623644_s_at:292:519; Interrogation_Position=340; Antisense; GTGGCGTACCCATAGCTAGATTTTG
>probe:Drosophila_2:1623644_s_at:636:547; Interrogation_Position=517; Antisense; GGAGTAATTATTCTGACTTCCAATA
>probe:Drosophila_2:1623644_s_at:432:707; Interrogation_Position=564; Antisense; TTACGGGTGCTTTCAGGAACCAATT
>probe:Drosophila_2:1623644_s_at:510:471; Interrogation_Position=607; Antisense; GTTCGCCTATGGGAATTCTAGTGTT

Paste this into a BLAST search page for me
AGAATGTTGATCTGTACGTGCCCCGAAATGCTCGGCGTCCAACAGGATCAAACAGGATCATCCACGCCAAGGATCTCCGTGCAGCTGAGCATCGTGGATGATCGTGGATGTGGACCCCGAGACCGAAGACCTACGCCATCTGCGGCGAGAAGATCCGTCGCATGGGCGAGTCCGAACTGCATCGTGCGTCTGGCCAAGAAGGACGGCATCATTACCAAGAACTTCCAAGAACTTCTAAGCGTGGCGTACCGTGGCGTACCCATAGCTAGATTTTGGGAGTAATTATTCTGACTTCCAATATTACGGGTGCTTTCAGGAACCAATTGTTCGCCTATGGGAATTCTAGTGTT

Full Affymetrix probeset data:

Annotations for 1623644_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime