FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623646_at:

>probe:Drosophila_2:1623646_at:10:289; Interrogation_Position=191; Antisense; CGGCGGTGGCCTTGGAAAGTCATCA
>probe:Drosophila_2:1623646_at:70:55; Interrogation_Position=259; Antisense; ATGACCTTCACGGTGTTCGTACTCA
>probe:Drosophila_2:1623646_at:265:473; Interrogation_Position=294; Antisense; GTTCTTCTTCGTTCACTGCTGGGAT
>probe:Drosophila_2:1623646_at:701:625; Interrogation_Position=346; Antisense; TGCCGCTGCATAATGTACCTGCTGA
>probe:Drosophila_2:1623646_at:97:79; Interrogation_Position=463; Antisense; AGGTCTCTTTGCACCTTTGAGGGAA
>probe:Drosophila_2:1623646_at:465:595; Interrogation_Position=489; Antisense; TGTGAAGTACTTGTTCTCGCGACCA
>probe:Drosophila_2:1623646_at:651:649; Interrogation_Position=529; Antisense; TCAGCTGTTTTCTTCTTGGGAGGAT
>probe:Drosophila_2:1623646_at:548:383; Interrogation_Position=583; Antisense; GAACTGAATATCGATCCCCATTGGT
>probe:Drosophila_2:1623646_at:725:295; Interrogation_Position=599; Antisense; CCCATTGGTCGGTGCGAGAGGCATT
>probe:Drosophila_2:1623646_at:224:515; Interrogation_Position=630; Antisense; GTGTCCAGAACCCACATATTTGCGT
>probe:Drosophila_2:1623646_at:253:13; Interrogation_Position=645; Antisense; ATATTTGCGTCATGAAGTTGGTCCA
>probe:Drosophila_2:1623646_at:703:591; Interrogation_Position=663; Antisense; TGGTCCAATCTTTGCACTTGTCAGA
>probe:Drosophila_2:1623646_at:253:39; Interrogation_Position=698; Antisense; ATCTAATGGGATTGGCTTTGGCCTC
>probe:Drosophila_2:1623646_at:571:581; Interrogation_Position=716; Antisense; TGGCCTCGCCACTATATAAGCTGTA

Paste this into a BLAST search page for me
CGGCGGTGGCCTTGGAAAGTCATCAATGACCTTCACGGTGTTCGTACTCAGTTCTTCTTCGTTCACTGCTGGGATTGCCGCTGCATAATGTACCTGCTGAAGGTCTCTTTGCACCTTTGAGGGAATGTGAAGTACTTGTTCTCGCGACCATCAGCTGTTTTCTTCTTGGGAGGATGAACTGAATATCGATCCCCATTGGTCCCATTGGTCGGTGCGAGAGGCATTGTGTCCAGAACCCACATATTTGCGTATATTTGCGTCATGAAGTTGGTCCATGGTCCAATCTTTGCACTTGTCAGAATCTAATGGGATTGGCTTTGGCCTCTGGCCTCGCCACTATATAAGCTGTA

Full Affymetrix probeset data:

Annotations for 1623646_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720