FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623647_at:

>probe:Drosophila_2:1623647_at:144:211; Interrogation_Position=1820; Antisense; AAGACACGAGTGTTCGGTTCGTCTC
>probe:Drosophila_2:1623647_at:51:541; Interrogation_Position=1835; Antisense; GGTTCGTCTCGGTGTTGCAACATGT
>probe:Drosophila_2:1623647_at:408:423; Interrogation_Position=1866; Antisense; GAGACGGCGATGCTTGTTTATATAC
>probe:Drosophila_2:1623647_at:439:475; Interrogation_Position=1921; Antisense; GTTAGTTGTCCTATTCGTGTTCGTA
>probe:Drosophila_2:1623647_at:615:363; Interrogation_Position=1949; Antisense; GAATTCATTGTCGAGCAAGCCACTG
>probe:Drosophila_2:1623647_at:63:199; Interrogation_Position=1979; Antisense; AACGATGTTCATGTCCATGTCCATC
>probe:Drosophila_2:1623647_at:36:63; Interrogation_Position=2007; Antisense; ATGTCCACCAGGAATCGCGTCTGCT
>probe:Drosophila_2:1623647_at:523:499; Interrogation_Position=2025; Antisense; GTCTGCTCGTCTAAATCTATTCCAA
>probe:Drosophila_2:1623647_at:387:671; Interrogation_Position=2073; Antisense; TACGCGTGTAACACCCAACTACTTA
>probe:Drosophila_2:1623647_at:351:383; Interrogation_Position=2118; Antisense; GAACGTAATGCACTTTCCAATCAAA
>probe:Drosophila_2:1623647_at:503:503; Interrogation_Position=2199; Antisense; GTCCACGCCAGGGTACGAATGTAAG
>probe:Drosophila_2:1623647_at:645:221; Interrogation_Position=2221; Antisense; AAGGTGTAGACTTCTGGCGCAGTAC
>probe:Drosophila_2:1623647_at:374:149; Interrogation_Position=2272; Antisense; ACTTATTCACGCCTGTTTGTCAATG
>probe:Drosophila_2:1623647_at:32:23; Interrogation_Position=2307; Antisense; ATATCATGGCGGGTTGTCAACGGAT

Paste this into a BLAST search page for me
AAGACACGAGTGTTCGGTTCGTCTCGGTTCGTCTCGGTGTTGCAACATGTGAGACGGCGATGCTTGTTTATATACGTTAGTTGTCCTATTCGTGTTCGTAGAATTCATTGTCGAGCAAGCCACTGAACGATGTTCATGTCCATGTCCATCATGTCCACCAGGAATCGCGTCTGCTGTCTGCTCGTCTAAATCTATTCCAATACGCGTGTAACACCCAACTACTTAGAACGTAATGCACTTTCCAATCAAAGTCCACGCCAGGGTACGAATGTAAGAAGGTGTAGACTTCTGGCGCAGTACACTTATTCACGCCTGTTTGTCAATGATATCATGGCGGGTTGTCAACGGAT

Full Affymetrix probeset data:

Annotations for 1623647_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720