FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623652_at:

>probe:Drosophila_2:1623652_at:140:73; Interrogation_Position=1030; Antisense; AGGAAGTGCTGGTTTGGCTGACAAA
>probe:Drosophila_2:1623652_at:474:73; Interrogation_Position=1059; Antisense; AGGAAGGCCATTGGCGATGACCCCT
>probe:Drosophila_2:1623652_at:308:445; Interrogation_Position=1074; Antisense; GATGACCCCTCCGATGAAGAGCTAA
>probe:Drosophila_2:1623652_at:326:631; Interrogation_Position=1178; Antisense; TCGGTTCGTCCTGCAAAACGAGTTT
>probe:Drosophila_2:1623652_at:685:663; Interrogation_Position=1234; Antisense; TAAAGCTGGTGACCCGCCTGTGGAA
>probe:Drosophila_2:1623652_at:601:185; Interrogation_Position=1287; Antisense; AACAAGGTAGCGAATCCGTATCCAA
>probe:Drosophila_2:1623652_at:50:683; Interrogation_Position=1305; Antisense; TATCCAAACGTCGATGCCCATTCGG
>probe:Drosophila_2:1623652_at:235:505; Interrogation_Position=1332; Antisense; GTCCTGCTGCAACATTACTGTCTGA
>probe:Drosophila_2:1623652_at:631:553; Interrogation_Position=1358; Antisense; GGAGCTGAAGTTCTACACAGTTCTT
>probe:Drosophila_2:1623652_at:4:259; Interrogation_Position=1373; Antisense; CACAGTTCTTTTCGGAGTTTCTCGG
>probe:Drosophila_2:1623652_at:404:275; Interrogation_Position=1401; Antisense; CTTGGAGTTCTGTCCCAGCTGATTT
>probe:Drosophila_2:1623652_at:225:263; Interrogation_Position=1416; Antisense; CAGCTGATTTGGTCCAGGGCTTTGG
>probe:Drosophila_2:1623652_at:79:213; Interrogation_Position=1454; Antisense; AAGACCAAAGTCATTTTCCTCCATC
>probe:Drosophila_2:1623652_at:262:17; Interrogation_Position=1466; Antisense; ATTTTCCTCCATCGAGATCTGCAAA

Paste this into a BLAST search page for me
AGGAAGTGCTGGTTTGGCTGACAAAAGGAAGGCCATTGGCGATGACCCCTGATGACCCCTCCGATGAAGAGCTAATCGGTTCGTCCTGCAAAACGAGTTTTAAAGCTGGTGACCCGCCTGTGGAAAACAAGGTAGCGAATCCGTATCCAATATCCAAACGTCGATGCCCATTCGGGTCCTGCTGCAACATTACTGTCTGAGGAGCTGAAGTTCTACACAGTTCTTCACAGTTCTTTTCGGAGTTTCTCGGCTTGGAGTTCTGTCCCAGCTGATTTCAGCTGATTTGGTCCAGGGCTTTGGAAGACCAAAGTCATTTTCCTCCATCATTTTCCTCCATCGAGATCTGCAAA

Full Affymetrix probeset data:

Annotations for 1623652_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720