FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623653_at:

>probe:Drosophila_2:1623653_at:419:499; Interrogation_Position=118; Antisense; GTCGATCCTAGAGCCTGCAAAATGG
>probe:Drosophila_2:1623653_at:172:85; Interrogation_Position=149; Antisense; AGTGGGTGGCACCAATCGTTATCAC
>probe:Drosophila_2:1623653_at:137:705; Interrogation_Position=167; Antisense; TTATCACCAGCATTTGGGCCTTCAT
>probe:Drosophila_2:1623653_at:393:531; Interrogation_Position=233; Antisense; GGGTGACTCAATGCTGCCTGATGCT
>probe:Drosophila_2:1623653_at:324:287; Interrogation_Position=282; Antisense; CTGGCTGTGCTGCTACATGACGCAG
>probe:Drosophila_2:1623653_at:130:239; Interrogation_Position=345; Antisense; AATCATGATCATGGCCCGCGAGTGG
>probe:Drosophila_2:1623653_at:104:69; Interrogation_Position=391; Antisense; ATGGCTGTCACCGTCTAATGTCTGT
>probe:Drosophila_2:1623653_at:678:499; Interrogation_Position=410; Antisense; GTCTGTCACCCTAATGTATTCGTTT
>probe:Drosophila_2:1623653_at:566:601; Interrogation_Position=444; Antisense; TGTTATTGTTTCTTTATCCCGGATT
>probe:Drosophila_2:1623653_at:500:303; Interrogation_Position=462; Antisense; CCGGATTTTCCGACATTCTGTATTA
>probe:Drosophila_2:1623653_at:618:239; Interrogation_Position=516; Antisense; AATAAATTGTAACCGCGGTCGCTCT
>probe:Drosophila_2:1623653_at:173:503; Interrogation_Position=533; Antisense; GTCGCTCTTGGCAAACACGTTGTAG
>probe:Drosophila_2:1623653_at:353:627; Interrogation_Position=619; Antisense; TGCCTTTTTGGCCAAGCATTCCCAA
>probe:Drosophila_2:1623653_at:169:345; Interrogation_Position=634; Antisense; GCATTCCCAATAATCGAGTGTCTTA

Paste this into a BLAST search page for me
GTCGATCCTAGAGCCTGCAAAATGGAGTGGGTGGCACCAATCGTTATCACTTATCACCAGCATTTGGGCCTTCATGGGTGACTCAATGCTGCCTGATGCTCTGGCTGTGCTGCTACATGACGCAGAATCATGATCATGGCCCGCGAGTGGATGGCTGTCACCGTCTAATGTCTGTGTCTGTCACCCTAATGTATTCGTTTTGTTATTGTTTCTTTATCCCGGATTCCGGATTTTCCGACATTCTGTATTAAATAAATTGTAACCGCGGTCGCTCTGTCGCTCTTGGCAAACACGTTGTAGTGCCTTTTTGGCCAAGCATTCCCAAGCATTCCCAATAATCGAGTGTCTTA

Full Affymetrix probeset data:

Annotations for 1623653_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720