FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623655_at:

>probe:Drosophila_2:1623655_at:136:507; Interrogation_Position=1074; Antisense; GTGCCCGGAGCCGATAATGTCGTTG
>probe:Drosophila_2:1623655_at:193:33; Interrogation_Position=1087; Antisense; ATAATGTCGTTGAGGCCACCATGCG
>probe:Drosophila_2:1623655_at:509:581; Interrogation_Position=1171; Antisense; TGGCCGCCAGCTCGTACCAGGAGTA
>probe:Drosophila_2:1623655_at:6:223; Interrogation_Position=1206; Antisense; AAGGGCTATGGCAAGCGCGGCTACA
>probe:Drosophila_2:1623655_at:610:205; Interrogation_Position=1218; Antisense; AAGCGCGGCTACATGGGCATCGCTA
>probe:Drosophila_2:1623655_at:6:65; Interrogation_Position=1230; Antisense; ATGGGCATCGCTACCGATTTCGATC
>probe:Drosophila_2:1623655_at:51:19; Interrogation_Position=1246; Antisense; ATTTCGATCTGCAGGGCGATTACAT
>probe:Drosophila_2:1623655_at:613:607; Interrogation_Position=1273; Antisense; TGCAGGTGAACTCGAAGAGCCCCTT
>probe:Drosophila_2:1623655_at:59:375; Interrogation_Position=1286; Antisense; GAAGAGCCCCTTCGGCAGGAGCACT
>probe:Drosophila_2:1623655_at:450:369; Interrogation_Position=1319; Antisense; GAAACAGACCGGCTACCACCAGGTC
>probe:Drosophila_2:1623655_at:360:79; Interrogation_Position=1375; Antisense; AGGGTTCCCGCCGTCAGTAGATCAT
>probe:Drosophila_2:1623655_at:260:485; Interrogation_Position=1391; Antisense; GTAGATCATCGCACAGTGATCCATC
>probe:Drosophila_2:1623655_at:440:85; Interrogation_Position=1405; Antisense; AGTGATCCATCGATGACAACCAGAT
>probe:Drosophila_2:1623655_at:354:311; Interrogation_Position=1488; Antisense; GCCAGTTGCATCCACTACGATTAGT

Paste this into a BLAST search page for me
GTGCCCGGAGCCGATAATGTCGTTGATAATGTCGTTGAGGCCACCATGCGTGGCCGCCAGCTCGTACCAGGAGTAAAGGGCTATGGCAAGCGCGGCTACAAAGCGCGGCTACATGGGCATCGCTAATGGGCATCGCTACCGATTTCGATCATTTCGATCTGCAGGGCGATTACATTGCAGGTGAACTCGAAGAGCCCCTTGAAGAGCCCCTTCGGCAGGAGCACTGAAACAGACCGGCTACCACCAGGTCAGGGTTCCCGCCGTCAGTAGATCATGTAGATCATCGCACAGTGATCCATCAGTGATCCATCGATGACAACCAGATGCCAGTTGCATCCACTACGATTAGT

Full Affymetrix probeset data:

Annotations for 1623655_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720