FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623657_at:

>probe:Drosophila_2:1623657_at:56:183; Interrogation_Position=384; Antisense; AAAAGCAGTCCTGAGCGTTTTGCAG
>probe:Drosophila_2:1623657_at:444:205; Interrogation_Position=433; Antisense; AAGCCCGAAGCTGCGAGTTGGATTC
>probe:Drosophila_2:1623657_at:114:531; Interrogation_Position=459; Antisense; GGGTCTGCCATTTGATTAATTGCTG
>probe:Drosophila_2:1623657_at:348:721; Interrogation_Position=478; Antisense; TTGCTGCCAAGTGAGCACAGACGGT
>probe:Drosophila_2:1623657_at:242:567; Interrogation_Position=536; Antisense; GGCACGGTTGCCAGTTGATTGACTC
>probe:Drosophila_2:1623657_at:468:259; Interrogation_Position=568; Antisense; CACTCTCCGGACCTTTTGTAGCGAA
>probe:Drosophila_2:1623657_at:139:655; Interrogation_Position=599; Antisense; TAACAAGTTTTTGTGCCGTTCCACT
>probe:Drosophila_2:1623657_at:222:145; Interrogation_Position=626; Antisense; ACTGCCGCCGTCGAAGGAGGCGAAT
>probe:Drosophila_2:1623657_at:517:99; Interrogation_Position=659; Antisense; AGACGGTTGGAGCTACAAGCTACAA
>probe:Drosophila_2:1623657_at:673:251; Interrogation_Position=674; Antisense; CAAGCTACAAGCTTCAAGCCTCGAA
>probe:Drosophila_2:1623657_at:483:725; Interrogation_Position=759; Antisense; TTGTATTCCTCATTTTGGCCGGGCA
>probe:Drosophila_2:1623657_at:389:93; Interrogation_Position=808; Antisense; AGTTGAGTCCATCTAGTCGCTTTTC
>probe:Drosophila_2:1623657_at:382:259; Interrogation_Position=842; Antisense; CACGGGTGTCTGCTGTGGACAATTC
>probe:Drosophila_2:1623657_at:513:381; Interrogation_Position=928; Antisense; GAACGCTAGAACTTCAGATCAATGC

Paste this into a BLAST search page for me
AAAAGCAGTCCTGAGCGTTTTGCAGAAGCCCGAAGCTGCGAGTTGGATTCGGGTCTGCCATTTGATTAATTGCTGTTGCTGCCAAGTGAGCACAGACGGTGGCACGGTTGCCAGTTGATTGACTCCACTCTCCGGACCTTTTGTAGCGAATAACAAGTTTTTGTGCCGTTCCACTACTGCCGCCGTCGAAGGAGGCGAATAGACGGTTGGAGCTACAAGCTACAACAAGCTACAAGCTTCAAGCCTCGAATTGTATTCCTCATTTTGGCCGGGCAAGTTGAGTCCATCTAGTCGCTTTTCCACGGGTGTCTGCTGTGGACAATTCGAACGCTAGAACTTCAGATCAATGC

Full Affymetrix probeset data:

Annotations for 1623657_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720