Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623658_at:

>probe:Drosophila_2:1623658_at:373:319; Interrogation_Position=115; Antisense; GCCCACATCCTGCAAGGCAATGGTT
>probe:Drosophila_2:1623658_at:13:67; Interrogation_Position=13; Antisense; ATGGTTCTGCTACTGGTGCACCTGC
>probe:Drosophila_2:1623658_at:364:623; Interrogation_Position=138; Antisense; TTACATGGGTTTCGGACGTCTTCGT
>probe:Drosophila_2:1623658_at:408:589; Interrogation_Position=171; Antisense; TGGATCCAAGGAGCCGTATCACTTC
>probe:Drosophila_2:1623658_at:414:481; Interrogation_Position=186; Antisense; GTATCACTTCCAATGGTGGGCCTAC
>probe:Drosophila_2:1623658_at:252:595; Interrogation_Position=202; Antisense; TGGGCCTACATCTACACCTGTTATG
>probe:Drosophila_2:1623658_at:393:131; Interrogation_Position=217; Antisense; ACCTGTTATGCATACGCCGTGCTGG
>probe:Drosophila_2:1623658_at:87:507; Interrogation_Position=235; Antisense; GTGCTGGTCAACTACGTCAACATGC
>probe:Drosophila_2:1623658_at:47:193; Interrogation_Position=244; Antisense; AACTACGTCAACATGCGCCGGCTGA
>probe:Drosophila_2:1623658_at:217:289; Interrogation_Position=262; Antisense; CGGCTGACCAACCTTATCGAATTTT
>probe:Drosophila_2:1623658_at:291:623; Interrogation_Position=35; Antisense; TGCGGCGCCTTATTTTGCTGCTGAC
>probe:Drosophila_2:1623658_at:371:687; Interrogation_Position=45; Antisense; TATTTTGCTGCTGACGGTCGTTTAC
>probe:Drosophila_2:1623658_at:24:611; Interrogation_Position=56; Antisense; TGACGGTCGTTTACCTGAGCGGAGC
>probe:Drosophila_2:1623658_at:300:417; Interrogation_Position=72; Antisense; GAGCGGAGCGGTATTCCGTCGCCTT

Paste this into a BLAST search page for me
GCCCACATCCTGCAAGGCAATGGTTATGGTTCTGCTACTGGTGCACCTGCTTACATGGGTTTCGGACGTCTTCGTTGGATCCAAGGAGCCGTATCACTTCGTATCACTTCCAATGGTGGGCCTACTGGGCCTACATCTACACCTGTTATGACCTGTTATGCATACGCCGTGCTGGGTGCTGGTCAACTACGTCAACATGCAACTACGTCAACATGCGCCGGCTGACGGCTGACCAACCTTATCGAATTTTTGCGGCGCCTTATTTTGCTGCTGACTATTTTGCTGCTGACGGTCGTTTACTGACGGTCGTTTACCTGAGCGGAGCGAGCGGAGCGGTATTCCGTCGCCTT

Full Affymetrix probeset data:

Annotations for 1623658_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime