FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623659_at:

>probe:Drosophila_2:1623659_at:529:621; Interrogation_Position=102; Antisense; TGCTGAGCTGCAACTATCCGATGAG
>probe:Drosophila_2:1623659_at:727:113; Interrogation_Position=125; Antisense; AGCAGAAGGCTGTGGCCCATGCCAA
>probe:Drosophila_2:1623659_at:313:71; Interrogation_Position=191; Antisense; AGGCGATCGCCTTGCGAAACGGCAA
>probe:Drosophila_2:1623659_at:256:363; Interrogation_Position=212; Antisense; GCAATTTCGATGACAGTGACCCCAA
>probe:Drosophila_2:1623659_at:80:597; Interrogation_Position=228; Antisense; TGACCCCAAGGTGAAATGCTTCGCC
>probe:Drosophila_2:1623659_at:272:53; Interrogation_Position=243; Antisense; ATGCTTCGCCAATTGTTTCTTGGAG
>probe:Drosophila_2:1623659_at:432:453; Interrogation_Position=282; Antisense; GATCAATGGTGAGGTCCAGCCCGAT
>probe:Drosophila_2:1623659_at:626:79; Interrogation_Position=30; Antisense; AGGGTTTCCAACAACATCTCTACCG
>probe:Drosophila_2:1623659_at:88:293; Interrogation_Position=303; Antisense; CGATGTCGTTCTGGCCAAGTTGGGA
>probe:Drosophila_2:1623659_at:281:471; Interrogation_Position=358; Antisense; GTTCAGGCCAAGTGTGATGCCACCA
>probe:Drosophila_2:1623659_at:254:417; Interrogation_Position=386; Antisense; GAGCGGATAAGTGCGATACTGCCTA
>probe:Drosophila_2:1623659_at:271:457; Interrogation_Position=400; Antisense; GATACTGCCTATCAGCTATTCGAGT
>probe:Drosophila_2:1623659_at:146:87; Interrogation_Position=422; Antisense; AGTGCTACTACAAGAATCGCGCCCA
>probe:Drosophila_2:1623659_at:429:165; Interrogation_Position=459; Antisense; AAATCTCCGATATTCTCCTGTGTGA

Paste this into a BLAST search page for me
TGCTGAGCTGCAACTATCCGATGAGAGCAGAAGGCTGTGGCCCATGCCAAAGGCGATCGCCTTGCGAAACGGCAAGCAATTTCGATGACAGTGACCCCAATGACCCCAAGGTGAAATGCTTCGCCATGCTTCGCCAATTGTTTCTTGGAGGATCAATGGTGAGGTCCAGCCCGATAGGGTTTCCAACAACATCTCTACCGCGATGTCGTTCTGGCCAAGTTGGGAGTTCAGGCCAAGTGTGATGCCACCAGAGCGGATAAGTGCGATACTGCCTAGATACTGCCTATCAGCTATTCGAGTAGTGCTACTACAAGAATCGCGCCCAAAATCTCCGATATTCTCCTGTGTGA

Full Affymetrix probeset data:

Annotations for 1623659_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720