FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623660_at:

>probe:Drosophila_2:1623660_at:341:419; Interrogation_Position=362; Antisense; GAGCTCATGAGCTTGGGCCACAGCT
>probe:Drosophila_2:1623660_at:84:119; Interrogation_Position=383; Antisense; AGCTCTGGCTCAACAATACTGACTC
>probe:Drosophila_2:1623660_at:616:241; Interrogation_Position=397; Antisense; AATACTGACTCAATTGGCCGTCGGC
>probe:Drosophila_2:1623660_at:217:577; Interrogation_Position=412; Antisense; GGCCGTCGGCGATGTCAAAGCTCAA
>probe:Drosophila_2:1623660_at:109:249; Interrogation_Position=505; Antisense; CAATACCACTTGTCCCTGGGTGAAA
>probe:Drosophila_2:1623660_at:346:229; Interrogation_Position=529; Antisense; AATGGAGCACGCACTGGAGCAGCAG
>probe:Drosophila_2:1623660_at:688:415; Interrogation_Position=563; Antisense; GAGCCGATGTCTGTGGAGCAACCGA
>probe:Drosophila_2:1623660_at:703:221; Interrogation_Position=651; Antisense; AAGGTGACTTCAATCGACGGGATCA
>probe:Drosophila_2:1623660_at:410:35; Interrogation_Position=672; Antisense; ATCAGGCTGAGAGCCGTCTGCGTAA
>probe:Drosophila_2:1623660_at:508:499; Interrogation_Position=687; Antisense; GTCTGCGTAAGGTTCCATCCAAGAT
>probe:Drosophila_2:1623660_at:312:207; Interrogation_Position=726; Antisense; AAGCTCCTGATCTCAACAGTGACGA
>probe:Drosophila_2:1623660_at:562:481; Interrogation_Position=751; Antisense; GTATTTCCCCAGTCTTAGCAAAGCA
>probe:Drosophila_2:1623660_at:206:143; Interrogation_Position=820; Antisense; ACTTACCGTTTCTGTTGTTCACTAT
>probe:Drosophila_2:1623660_at:153:17; Interrogation_Position=859; Antisense; ATTTTTCTGGTCGATCTGATGCGGG

Paste this into a BLAST search page for me
GAGCTCATGAGCTTGGGCCACAGCTAGCTCTGGCTCAACAATACTGACTCAATACTGACTCAATTGGCCGTCGGCGGCCGTCGGCGATGTCAAAGCTCAACAATACCACTTGTCCCTGGGTGAAAAATGGAGCACGCACTGGAGCAGCAGGAGCCGATGTCTGTGGAGCAACCGAAAGGTGACTTCAATCGACGGGATCAATCAGGCTGAGAGCCGTCTGCGTAAGTCTGCGTAAGGTTCCATCCAAGATAAGCTCCTGATCTCAACAGTGACGAGTATTTCCCCAGTCTTAGCAAAGCAACTTACCGTTTCTGTTGTTCACTATATTTTTCTGGTCGATCTGATGCGGG

Full Affymetrix probeset data:

Annotations for 1623660_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720