FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623662_at:

>probe:Drosophila_2:1623662_at:292:687; Interrogation_Position=1555; Antisense; TATAAGAGCACCCTGGCCGTCTATG
>probe:Drosophila_2:1623662_at:69:205; Interrogation_Position=1612; Antisense; AAGCCTTTTCACAGTCGCATCGACA
>probe:Drosophila_2:1623662_at:39:627; Interrogation_Position=1654; Antisense; TGCCGGCAGTGCTTTAATGTTGACA
>probe:Drosophila_2:1623662_at:294:467; Interrogation_Position=1672; Antisense; GTTGACACTTTGATCATACGCGAAA
>probe:Drosophila_2:1623662_at:631:321; Interrogation_Position=1691; Antisense; GCGAAAAAGTTTCCACCTCGACGCT
>probe:Drosophila_2:1623662_at:332:307; Interrogation_Position=1706; Antisense; CCTCGACGCTTTTACTCATTGCAAA
>probe:Drosophila_2:1623662_at:69:211; Interrogation_Position=1738; Antisense; AAGAATCTGCAGCATCTTCACGTGC
>probe:Drosophila_2:1623662_at:533:139; Interrogation_Position=1757; Antisense; ACGTGCGGCGATTTGCTGTGATTTT
>probe:Drosophila_2:1623662_at:8:515; Interrogation_Position=1774; Antisense; GTGATTTTGCGATGCGATTGGCCAA
>probe:Drosophila_2:1623662_at:94:363; Interrogation_Position=1814; Antisense; GCAATGAGTTCTATGCCTGGTTGAA
>probe:Drosophila_2:1623662_at:401:395; Interrogation_Position=1841; Antisense; GAAATTCCCGATCCTATGAAGCCGT
>probe:Drosophila_2:1623662_at:225:319; Interrogation_Position=1861; Antisense; GCCGTCGAGCGGGAGATCTCACAAA
>probe:Drosophila_2:1623662_at:268:237; Interrogation_Position=1884; Antisense; AATCTTGGGCTACAAGTGGCGCCTT
>probe:Drosophila_2:1623662_at:497:311; Interrogation_Position=1904; Antisense; GCCTTCTTAGCGATCGAGACTTCAA

Paste this into a BLAST search page for me
TATAAGAGCACCCTGGCCGTCTATGAAGCCTTTTCACAGTCGCATCGACATGCCGGCAGTGCTTTAATGTTGACAGTTGACACTTTGATCATACGCGAAAGCGAAAAAGTTTCCACCTCGACGCTCCTCGACGCTTTTACTCATTGCAAAAAGAATCTGCAGCATCTTCACGTGCACGTGCGGCGATTTGCTGTGATTTTGTGATTTTGCGATGCGATTGGCCAAGCAATGAGTTCTATGCCTGGTTGAAGAAATTCCCGATCCTATGAAGCCGTGCCGTCGAGCGGGAGATCTCACAAAAATCTTGGGCTACAAGTGGCGCCTTGCCTTCTTAGCGATCGAGACTTCAA

Full Affymetrix probeset data:

Annotations for 1623662_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720