Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623663_a_at:

>probe:Drosophila_2:1623663_a_at:79:333; Interrogation_Position=1021; Antisense; GCTGGACTCTTTGATGACACCTTTA
>probe:Drosophila_2:1623663_a_at:75:131; Interrogation_Position=1039; Antisense; ACCTTTACTTGTGTTCTTCTTGCAG
>probe:Drosophila_2:1623663_a_at:222:131; Interrogation_Position=539; Antisense; ACCTGATTCACTCTTTGGTCAATTA
>probe:Drosophila_2:1623663_a_at:418:619; Interrogation_Position=590; Antisense; TGCTTCCAGGCATTTACACGATACG
>probe:Drosophila_2:1623663_a_at:214:157; Interrogation_Position=605; Antisense; ACACGATACGGGACTCGAGCATATG
>probe:Drosophila_2:1623663_a_at:482:143; Interrogation_Position=648; Antisense; ACTGATGGCAACATTTGGCTTTCGA
>probe:Drosophila_2:1623663_a_at:442:569; Interrogation_Position=664; Antisense; GGCTTTCGATTCTATAACGCTAATG
>probe:Drosophila_2:1623663_a_at:325:393; Interrogation_Position=734; Antisense; GAAAGACGTTTACGGCCACATCCTA
>probe:Drosophila_2:1623663_a_at:717:545; Interrogation_Position=765; Antisense; GGATGTACCATATCCCGGGTTTAAT
>probe:Drosophila_2:1623663_a_at:700:245; Interrogation_Position=817; Antisense; AATTCTGCCATGACCTTGAATGCCA
>probe:Drosophila_2:1623663_a_at:284:605; Interrogation_Position=863; Antisense; TGATTCACATATTCCTGTCCGGTAG
>probe:Drosophila_2:1623663_a_at:532:729; Interrogation_Position=896; Antisense; TTGGCATGACAACGGCTAAGCTCGA
>probe:Drosophila_2:1623663_a_at:476:107; Interrogation_Position=945; Antisense; AGAAAATCATCACTGTCTCTCTCTC
>probe:Drosophila_2:1623663_a_at:239:451; Interrogation_Position=997; Antisense; GATCGAACACACCTTGATGGCCAAG

Paste this into a BLAST search page for me
GCTGGACTCTTTGATGACACCTTTAACCTTTACTTGTGTTCTTCTTGCAGACCTGATTCACTCTTTGGTCAATTATGCTTCCAGGCATTTACACGATACGACACGATACGGGACTCGAGCATATGACTGATGGCAACATTTGGCTTTCGAGGCTTTCGATTCTATAACGCTAATGGAAAGACGTTTACGGCCACATCCTAGGATGTACCATATCCCGGGTTTAATAATTCTGCCATGACCTTGAATGCCATGATTCACATATTCCTGTCCGGTAGTTGGCATGACAACGGCTAAGCTCGAAGAAAATCATCACTGTCTCTCTCTCGATCGAACACACCTTGATGGCCAAG

Full Affymetrix probeset data:

Annotations for 1623663_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime