FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623665_at:

>probe:Drosophila_2:1623665_at:538:359; Interrogation_Position=116; Antisense; GCAACTCCCGTAGTCGTAGTGACAG
>probe:Drosophila_2:1623665_at:272:485; Interrogation_Position=131; Antisense; GTAGTGACAGCCTTTGCCGGATCCG
>probe:Drosophila_2:1623665_at:413:71; Interrogation_Position=195; Antisense; ACCAGGACCTGTACCGCTGGGCAAA
>probe:Drosophila_2:1623665_at:476:463; Interrogation_Position=20; Antisense; GATTGGGCCCACTGTGCTTCGGCAA
>probe:Drosophila_2:1623665_at:413:275; Interrogation_Position=229; Antisense; CTTCGCCCGGAGAGGAGAGCAGTCT
>probe:Drosophila_2:1623665_at:101:619; Interrogation_Position=34; Antisense; TGCTTCGGCAACAGAGCGACTCGTG
>probe:Drosophila_2:1623665_at:632:597; Interrogation_Position=357; Antisense; TGTGCCACTCAGTTACGCGCAACAT
>probe:Drosophila_2:1623665_at:576:151; Interrogation_Position=378; Antisense; ACATTTCAACGCAACGTCGTGGCAA
>probe:Drosophila_2:1623665_at:386:585; Interrogation_Position=397; Antisense; TGGCAATTCCAAATCGGCGGCAGAC
>probe:Drosophila_2:1623665_at:416:123; Interrogation_Position=434; Antisense; AGCGCACGGGCGGATTGCACGTAAT
>probe:Drosophila_2:1623665_at:647:723; Interrogation_Position=448; Antisense; TTGCACGTAATAAATCCTCCGGAAC
>probe:Drosophila_2:1623665_at:481:141; Interrogation_Position=484; Antisense; ACGGCAAACGCAACTAATCACACAC
>probe:Drosophila_2:1623665_at:692:285; Interrogation_Position=55; Antisense; CGTGCCGAGCCGATGGAAACCGAAA
>probe:Drosophila_2:1623665_at:687:135; Interrogation_Position=79; Antisense; ACGAAACCGGGCTGCTGGCTGATGT

Paste this into a BLAST search page for me
GCAACTCCCGTAGTCGTAGTGACAGGTAGTGACAGCCTTTGCCGGATCCGACCAGGACCTGTACCGCTGGGCAAAGATTGGGCCCACTGTGCTTCGGCAACTTCGCCCGGAGAGGAGAGCAGTCTTGCTTCGGCAACAGAGCGACTCGTGTGTGCCACTCAGTTACGCGCAACATACATTTCAACGCAACGTCGTGGCAATGGCAATTCCAAATCGGCGGCAGACAGCGCACGGGCGGATTGCACGTAATTTGCACGTAATAAATCCTCCGGAACACGGCAAACGCAACTAATCACACACCGTGCCGAGCCGATGGAAACCGAAAACGAAACCGGGCTGCTGGCTGATGT

Full Affymetrix probeset data:

Annotations for 1623665_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720