FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623666_at:

>probe:Drosophila_2:1623666_at:678:451; Interrogation_Position=1039; Antisense; GATCTGGGCGACGAAGCAGTGCTCT
>probe:Drosophila_2:1623666_at:216:437; Interrogation_Position=1129; Antisense; GAGGACGACTTGTACGCCAATGCAC
>probe:Drosophila_2:1623666_at:135:157; Interrogation_Position=1196; Antisense; ACACCGCTAGTGTCCACGAGATGTG
>probe:Drosophila_2:1623666_at:640:137; Interrogation_Position=1211; Antisense; ACGAGATGTGCGACGAGTACTTCCA
>probe:Drosophila_2:1623666_at:163:259; Interrogation_Position=1234; Antisense; CACTACCTGCTTTAGTCTTACCAAG
>probe:Drosophila_2:1623666_at:673:283; Interrogation_Position=702; Antisense; CTGCTTGATTGGTGTCTGTTTGGAT
>probe:Drosophila_2:1623666_at:479:199; Interrogation_Position=729; Antisense; AACGCGTGGGCACTTGGAGTTCTAT
>probe:Drosophila_2:1623666_at:712:471; Interrogation_Position=747; Antisense; GTTCTATTTGAACCGCAGATCGCTG
>probe:Drosophila_2:1623666_at:66:99; Interrogation_Position=763; Antisense; AGATCGCTGGGAGTGGCCTACACCA
>probe:Drosophila_2:1623666_at:721:13; Interrogation_Position=853; Antisense; ATTAGGCTGATCAACTGCACTTCGC
>probe:Drosophila_2:1623666_at:718:451; Interrogation_Position=899; Antisense; GATCTTTCCAAGCATTGTCCAGGCA
>probe:Drosophila_2:1623666_at:603:161; Interrogation_Position=931; Antisense; AAATTGGCCGAACTGCGTCAAATGC
>probe:Drosophila_2:1623666_at:267:305; Interrogation_Position=955; Antisense; CCGGGTCTCAAAGGCATCATGCAAT
>probe:Drosophila_2:1623666_at:203:37; Interrogation_Position=970; Antisense; ATCATGCAATCCTACTGGTTCCTGG

Paste this into a BLAST search page for me
GATCTGGGCGACGAAGCAGTGCTCTGAGGACGACTTGTACGCCAATGCACACACCGCTAGTGTCCACGAGATGTGACGAGATGTGCGACGAGTACTTCCACACTACCTGCTTTAGTCTTACCAAGCTGCTTGATTGGTGTCTGTTTGGATAACGCGTGGGCACTTGGAGTTCTATGTTCTATTTGAACCGCAGATCGCTGAGATCGCTGGGAGTGGCCTACACCAATTAGGCTGATCAACTGCACTTCGCGATCTTTCCAAGCATTGTCCAGGCAAAATTGGCCGAACTGCGTCAAATGCCCGGGTCTCAAAGGCATCATGCAATATCATGCAATCCTACTGGTTCCTGG

Full Affymetrix probeset data:

Annotations for 1623666_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720