FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623668_at:

>probe:Drosophila_2:1623668_at:331:407; Interrogation_Position=4318; Antisense; GACGGCATTGCCTCCATTATCGAAG
>probe:Drosophila_2:1623668_at:436:375; Interrogation_Position=4339; Antisense; GAAGATGCAGCTCAGTCCGCTGGAA
>probe:Drosophila_2:1623668_at:234:557; Interrogation_Position=4366; Antisense; GGACAACCGGGTAGCCAGACGTATT
>probe:Drosophila_2:1623668_at:369:421; Interrogation_Position=4393; Antisense; GAGCAACGCTTTGGTCAACTGGACA
>probe:Drosophila_2:1623668_at:72:655; Interrogation_Position=4476; Antisense; TAATTTCAAGATGCCGTGTGGACGC
>probe:Drosophila_2:1623668_at:671:287; Interrogation_Position=4500; Antisense; CGGACAGATCATTCGGGTGGACACC
>probe:Drosophila_2:1623668_at:223:55; Interrogation_Position=4556; Antisense; ATGACAATCGGTTCGAGGACCTCGA
>probe:Drosophila_2:1623668_at:208:219; Interrogation_Position=4596; Antisense; AAGTCACAGTCGTCGATCGCCGGAA
>probe:Drosophila_2:1623668_at:411:199; Interrogation_Position=4624; Antisense; AACGCAGTCGTTGCTTGTGATCTCA
>probe:Drosophila_2:1623668_at:357:343; Interrogation_Position=4636; Antisense; GCTTGTGATCTCAGCGATGCGGAAT
>probe:Drosophila_2:1623668_at:469:37; Interrogation_Position=4659; Antisense; ATCTGATAAAACTCTGACCCGTTCC
>probe:Drosophila_2:1623668_at:422:65; Interrogation_Position=4760; Antisense; ATGGACGCGGACGAAGTACCTGCTG
>probe:Drosophila_2:1623668_at:209:487; Interrogation_Position=4775; Antisense; GTACCTGCTGTGGATCTTCGGAAAC
>probe:Drosophila_2:1623668_at:81:137; Interrogation_Position=4855; Antisense; ACGCACTCTGTGCTCTACAAGATGA

Paste this into a BLAST search page for me
GACGGCATTGCCTCCATTATCGAAGGAAGATGCAGCTCAGTCCGCTGGAAGGACAACCGGGTAGCCAGACGTATTGAGCAACGCTTTGGTCAACTGGACATAATTTCAAGATGCCGTGTGGACGCCGGACAGATCATTCGGGTGGACACCATGACAATCGGTTCGAGGACCTCGAAAGTCACAGTCGTCGATCGCCGGAAAACGCAGTCGTTGCTTGTGATCTCAGCTTGTGATCTCAGCGATGCGGAATATCTGATAAAACTCTGACCCGTTCCATGGACGCGGACGAAGTACCTGCTGGTACCTGCTGTGGATCTTCGGAAACACGCACTCTGTGCTCTACAAGATGA

Full Affymetrix probeset data:

Annotations for 1623668_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720