Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623670_at:

>probe:Drosophila_2:1623670_at:256:303; Interrogation_Position=4163; Antisense; CCGCCTTTTTGTGGCAGTATGGAAA
>probe:Drosophila_2:1623670_at:357:481; Interrogation_Position=4188; Antisense; GTCTTGCGGGTTTACGCCAAAGCAT
>probe:Drosophila_2:1623670_at:397:593; Interrogation_Position=4213; Antisense; TGGGAGAGCCTCTTGCGGAAAATAC
>probe:Drosophila_2:1623670_at:542:563; Interrogation_Position=4265; Antisense; GGAAGGCACACATTACGGAGATTTT
>probe:Drosophila_2:1623670_at:709:249; Interrogation_Position=4293; Antisense; CAATCTGGTGGCTGAGCTGAGCTTT
>probe:Drosophila_2:1623670_at:219:195; Interrogation_Position=4322; Antisense; AACTGTTGCAATGCTTTCCCAGCGA
>probe:Drosophila_2:1623670_at:545:687; Interrogation_Position=4375; Antisense; TATTTCGCCACGGAATTTGCCGAGA
>probe:Drosophila_2:1623670_at:343:531; Interrogation_Position=4455; Antisense; GGGTCACAGGGATCACATGCCGATG
>probe:Drosophila_2:1623670_at:710:207; Interrogation_Position=4534; Antisense; AAGCAGCGGAGTATTGCCCTGCGGT
>probe:Drosophila_2:1623670_at:126:623; Interrogation_Position=4553; Antisense; TGCGGTCCATGATCGAGTCCACAGG
>probe:Drosophila_2:1623670_at:700:153; Interrogation_Position=4573; Antisense; ACAGGAACTCAGCTGTTCGACGCAA
>probe:Drosophila_2:1623670_at:280:471; Interrogation_Position=4587; Antisense; GTTCGACGCAACTAGTAATCCCATG
>probe:Drosophila_2:1623670_at:109:235; Interrogation_Position=4603; Antisense; AATCCCATGTATAACCTGTAGGCGA
>probe:Drosophila_2:1623670_at:12:391; Interrogation_Position=4705; Antisense; GAAAGCTTTTCCACTTTTACCACAG

Paste this into a BLAST search page for me
CCGCCTTTTTGTGGCAGTATGGAAAGTCTTGCGGGTTTACGCCAAAGCATTGGGAGAGCCTCTTGCGGAAAATACGGAAGGCACACATTACGGAGATTTTCAATCTGGTGGCTGAGCTGAGCTTTAACTGTTGCAATGCTTTCCCAGCGATATTTCGCCACGGAATTTGCCGAGAGGGTCACAGGGATCACATGCCGATGAAGCAGCGGAGTATTGCCCTGCGGTTGCGGTCCATGATCGAGTCCACAGGACAGGAACTCAGCTGTTCGACGCAAGTTCGACGCAACTAGTAATCCCATGAATCCCATGTATAACCTGTAGGCGAGAAAGCTTTTCCACTTTTACCACAG

Full Affymetrix probeset data:

Annotations for 1623670_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime