Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623672_at:

>probe:Drosophila_2:1623672_at:470:237; Interrogation_Position=2009; Antisense; AATCGGCAGCTGGTTTTGGTGATCC
>probe:Drosophila_2:1623672_at:463:533; Interrogation_Position=2026; Antisense; GGTGATCCAAACGTCGATTTTCCTC
>probe:Drosophila_2:1623672_at:368:293; Interrogation_Position=2040; Antisense; CGATTTTCCTCCAGCAGACTACCAG
>probe:Drosophila_2:1623672_at:338:495; Interrogation_Position=2070; Antisense; GTCAACCGACGCTTCACATATATAT
>probe:Drosophila_2:1623672_at:670:701; Interrogation_Position=2096; Antisense; TTATTCCTAAGGCAAGACCCACCAG
>probe:Drosophila_2:1623672_at:457:309; Interrogation_Position=2114; Antisense; CCACCAGGAGGGATTCTTATTCAAT
>probe:Drosophila_2:1623672_at:544:393; Interrogation_Position=2179; Antisense; GAAAGTGTTACTCCTGCTGACGAGA
>probe:Drosophila_2:1623672_at:448:553; Interrogation_Position=2266; Antisense; GGACTAACCACACAACAATTTTCAT
>probe:Drosophila_2:1623672_at:375:403; Interrogation_Position=2302; Antisense; GACTTTCATGGAGTAAGCCCACCTC
>probe:Drosophila_2:1623672_at:420:631; Interrogation_Position=2325; Antisense; TCCTCCATGGGAAGAGCTATCCGAT
>probe:Drosophila_2:1623672_at:507:453; Interrogation_Position=2389; Antisense; GATAAGTATCGACCAAATGCAGACC
>probe:Drosophila_2:1623672_at:14:233; Interrogation_Position=2404; Antisense; AATGCAGACCGTTGGGCTGAGCCAT
>probe:Drosophila_2:1623672_at:339:415; Interrogation_Position=2422; Antisense; GAGCCATTAATTACCAGAGAGCCTT
>probe:Drosophila_2:1623672_at:241:415; Interrogation_Position=2440; Antisense; GAGCCTTATCCAATAAACCTTCCAG

Paste this into a BLAST search page for me
AATCGGCAGCTGGTTTTGGTGATCCGGTGATCCAAACGTCGATTTTCCTCCGATTTTCCTCCAGCAGACTACCAGGTCAACCGACGCTTCACATATATATTTATTCCTAAGGCAAGACCCACCAGCCACCAGGAGGGATTCTTATTCAATGAAAGTGTTACTCCTGCTGACGAGAGGACTAACCACACAACAATTTTCATGACTTTCATGGAGTAAGCCCACCTCTCCTCCATGGGAAGAGCTATCCGATGATAAGTATCGACCAAATGCAGACCAATGCAGACCGTTGGGCTGAGCCATGAGCCATTAATTACCAGAGAGCCTTGAGCCTTATCCAATAAACCTTCCAG

Full Affymetrix probeset data:

Annotations for 1623672_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime