Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623673_at:

>probe:Drosophila_2:1623673_at:254:225; Interrogation_Position=1260; Antisense; AAGGAGTGTGCCTGACATCCTGCGG
>probe:Drosophila_2:1623673_at:242:617; Interrogation_Position=1331; Antisense; TGCACAGTCACAACGCGGAGCAGCA
>probe:Drosophila_2:1623673_at:107:465; Interrogation_Position=1368; Antisense; GTTGGCAGTGGACAGAAACTCCTTT
>probe:Drosophila_2:1623673_at:121:193; Interrogation_Position=1384; Antisense; AACTCCTTTAGGGAGCTGGCTGGTC
>probe:Drosophila_2:1623673_at:384:587; Interrogation_Position=1404; Antisense; TGGTCCGGCACAGAAGTTGGCCCAA
>probe:Drosophila_2:1623673_at:578:465; Interrogation_Position=1419; Antisense; GTTGGCCCAACGTATCAGTACTATG
>probe:Drosophila_2:1623673_at:359:265; Interrogation_Position=1434; Antisense; CAGTACTATGGGTTTCCCTCTGGAA
>probe:Drosophila_2:1623673_at:667:705; Interrogation_Position=1475; Antisense; TTAGTCTATGCGGTATCGACGATAA
>probe:Drosophila_2:1623673_at:269:683; Interrogation_Position=1506; Antisense; TATCGAACACCTTATTCCACTGGGA
>probe:Drosophila_2:1623673_at:660:421; Interrogation_Position=1529; Antisense; GAGAACTTCTGGACCTCGGTTTTGA
>probe:Drosophila_2:1623673_at:485:365; Interrogation_Position=1555; Antisense; GAATCGAAAATCTCGGCGGCGCTAC
>probe:Drosophila_2:1623673_at:60:333; Interrogation_Position=1570; Antisense; GCGGCGCTACTCAAGTTCAACAATA
>probe:Drosophila_2:1623673_at:393:397; Interrogation_Position=1600; Antisense; GACAAGGCGCTGGACTATCTAATCA
>probe:Drosophila_2:1623673_at:650:299; Interrogation_Position=1691; Antisense; CCCACCCCAATTAGCTTACAAAGAT

Paste this into a BLAST search page for me
AAGGAGTGTGCCTGACATCCTGCGGTGCACAGTCACAACGCGGAGCAGCAGTTGGCAGTGGACAGAAACTCCTTTAACTCCTTTAGGGAGCTGGCTGGTCTGGTCCGGCACAGAAGTTGGCCCAAGTTGGCCCAACGTATCAGTACTATGCAGTACTATGGGTTTCCCTCTGGAATTAGTCTATGCGGTATCGACGATAATATCGAACACCTTATTCCACTGGGAGAGAACTTCTGGACCTCGGTTTTGAGAATCGAAAATCTCGGCGGCGCTACGCGGCGCTACTCAAGTTCAACAATAGACAAGGCGCTGGACTATCTAATCACCCACCCCAATTAGCTTACAAAGAT

Full Affymetrix probeset data:

Annotations for 1623673_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime