FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623675_at:

>probe:Drosophila_2:1623675_at:605:211; Interrogation_Position=117; Antisense; AAGACGCACGAGGATCTGACCAACT
>probe:Drosophila_2:1623675_at:89:41; Interrogation_Position=130; Antisense; ATCTGACCAACTATCGCACGCAGTG
>probe:Drosophila_2:1623675_at:370:223; Interrogation_Position=162; Antisense; AAGGTTCACGCCAGCGAGGAGCTCG
>probe:Drosophila_2:1623675_at:309:211; Interrogation_Position=198; Antisense; AAGAAGTGGCAGTACCCCGATGACG
>probe:Drosophila_2:1623675_at:173:143; Interrogation_Position=232; Antisense; ACTGCTACCTGGAGTGCATCTTCCA
>probe:Drosophila_2:1623675_at:610:109; Interrogation_Position=256; Antisense; AGAAGTTCGGCTTCTACGACACCGA
>probe:Drosophila_2:1623675_at:277:421; Interrogation_Position=279; Antisense; GAGCACGGATTCGATGTCCACAAGA
>probe:Drosophila_2:1623675_at:441:319; Interrogation_Position=322; Antisense; GCCCTGGAGTTGAGGTGCACGAATC
>probe:Drosophila_2:1623675_at:613:115; Interrogation_Position=33; Antisense; AGCATGAAGGTTCTCATCGTTCTCC
>probe:Drosophila_2:1623675_at:369:135; Interrogation_Position=340; Antisense; ACGAATCGGACGAGGTGCACCAGAA
>probe:Drosophila_2:1623675_at:578:305; Interrogation_Position=427; Antisense; CCGGCATGTGCTTCATGAACTCCAA
>probe:Drosophila_2:1623675_at:488:613; Interrogation_Position=442; Antisense; TGAACTCCAACCTGCAGCTGGTGCA
>probe:Drosophila_2:1623675_at:637:41; Interrogation_Position=48; Antisense; ATCGTTCTCCTATTGGGTCTGGCCT
>probe:Drosophila_2:1623675_at:29:381; Interrogation_Position=510; Antisense; GAACCATCTGATCGCTTGTCTAAAG

Paste this into a BLAST search page for me
AAGACGCACGAGGATCTGACCAACTATCTGACCAACTATCGCACGCAGTGAAGGTTCACGCCAGCGAGGAGCTCGAAGAAGTGGCAGTACCCCGATGACGACTGCTACCTGGAGTGCATCTTCCAAGAAGTTCGGCTTCTACGACACCGAGAGCACGGATTCGATGTCCACAAGAGCCCTGGAGTTGAGGTGCACGAATCAGCATGAAGGTTCTCATCGTTCTCCACGAATCGGACGAGGTGCACCAGAACCGGCATGTGCTTCATGAACTCCAATGAACTCCAACCTGCAGCTGGTGCAATCGTTCTCCTATTGGGTCTGGCCTGAACCATCTGATCGCTTGTCTAAAG

Full Affymetrix probeset data:

Annotations for 1623675_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720