FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623678_at:

>probe:Drosophila_2:1623678_at:455:117; Interrogation_Position=1276; Antisense; AGCTTAATACGCTGCTGCTGCACGG
>probe:Drosophila_2:1623678_at:7:523; Interrogation_Position=1308; Antisense; GTGGCGGAAAATCCCCGTGTCAACT
>probe:Drosophila_2:1623678_at:382:513; Interrogation_Position=1324; Antisense; GTGTCAACTTCTGTCGCGGTACAAA
>probe:Drosophila_2:1623678_at:677:149; Interrogation_Position=1352; Antisense; ACTTCCACTGTACGCCGAGATTTCG
>probe:Drosophila_2:1623678_at:695:17; Interrogation_Position=1396; Antisense; ATTTCAACGATAACGCACTGCGGCA
>probe:Drosophila_2:1623678_at:78:235; Interrogation_Position=1440; Antisense; AATGCGCCATCGATTCAGCGGAGCA
>probe:Drosophila_2:1623678_at:275:479; Interrogation_Position=1497; Antisense; GTTTCCGCCTATGAGAACGCCGAAC
>probe:Drosophila_2:1623678_at:590:299; Interrogation_Position=1514; Antisense; CGCCGAACAGCGTGACTTTATCAAT
>probe:Drosophila_2:1623678_at:606:21; Interrogation_Position=1550; Antisense; ATATTTGGCATCAAACCGACCGCGA
>probe:Drosophila_2:1623678_at:55:397; Interrogation_Position=1573; Antisense; GACACTTGGAGCTGCCCGAAATCTA
>probe:Drosophila_2:1623678_at:524:661; Interrogation_Position=1625; Antisense; TAACAACAATCGTGCCATGGAGGCT
>probe:Drosophila_2:1623678_at:519:279; Interrogation_Position=1648; Antisense; CTAAGAGACGCTTCTTCGAGCTGGA
>probe:Drosophila_2:1623678_at:82:559; Interrogation_Position=1670; Antisense; GGACATCAATCCTTGGCAGCGAACG
>probe:Drosophila_2:1623678_at:246:223; Interrogation_Position=1710; Antisense; AAGGAGTATGTTCCACGTGCGGTCC

Paste this into a BLAST search page for me
AGCTTAATACGCTGCTGCTGCACGGGTGGCGGAAAATCCCCGTGTCAACTGTGTCAACTTCTGTCGCGGTACAAAACTTCCACTGTACGCCGAGATTTCGATTTCAACGATAACGCACTGCGGCAAATGCGCCATCGATTCAGCGGAGCAGTTTCCGCCTATGAGAACGCCGAACCGCCGAACAGCGTGACTTTATCAATATATTTGGCATCAAACCGACCGCGAGACACTTGGAGCTGCCCGAAATCTATAACAACAATCGTGCCATGGAGGCTCTAAGAGACGCTTCTTCGAGCTGGAGGACATCAATCCTTGGCAGCGAACGAAGGAGTATGTTCCACGTGCGGTCC

Full Affymetrix probeset data:

Annotations for 1623678_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720